René St-Arnaud¹, G. Antonio Candeliere¹, and Shoukat Dedhar²

¹Genetics Unit, Shriners Hospital, and Departments of Surgery and Human Genetics, McGill University, Montréal (Québec) Canada H3G1A6

²Division of Cancer Research and Department of Medical Biophysics, University of Toronto, Reichmann Research Building, Sunnybrook Health Science Centre, Toronto (Ontario) Canada M4N 3M5

Received 07/05/96; Accepted 07/12/96; On-line 08/01/96

3.1. In various promoters

Rhodes et al. (37) have recently described a composite retinoic acid (RA)- and vitamin D-response element (RDE). This element has a DR4-type structure with two AGTTCA hexameric sites (on the non-coding strand) spaced by 4 residues. The transcriptional response to 1,25 (OH)₂D₃ mediated through the RDE was exceptionally high and the element was shown to bind VDR-RXR heterodimers, but not VDR homodimers (37). A DR4-like element has also been described in the promoter of the calbindin D-28k gene (38). The VDR was shown to bind that element but the putative dimerizing partners involved were not characterized (38).

In contrast, the DR6-type element of the human osteocalcin VDRE consists of two GGGTGA hexameric consensus sites spaced by 6 residues (39, 40). It has been shown to bind preferentially to VDR-RAR and VDR-T₃R heterodimers (34, 35), as well as to VDR homodimers, although with lower affinity (26; 35).

Other structural motifs that have been shown to mediate transcriptional induction by the VDR alone, and thus inferred to bind VDR homodimers, include a palindrome of the GGGTGA core site with no intervening residue and an inverted palindrome of the same hexameric site spaced by 12 residues (26). Following this initial observation that inverted palindromic elements can mediate the transcriptional response to vitamin D, the laboratory of Carsten Carlberg in Geneva initiated an exhaustive search for inverted palindrome that would respond to each of the vitamin D transcriptional pathways (VDR homodimers and VDR-RXR, VDR-RAR, and VDR-T₃R heterodimers). First utilizing synthetic elements, they have shown that VDR-RAR dimers exhibit preferential binding affinity for motifs in which the core hexameric sites are spaced by 11 residues (inverted palindrome 11 or IP11) (41), whereas VDR-RXR and VDR-T₃R heterodimers show maximal affinity for IP9 and IP7 motifs, respectively (35; 41).

Until recently, the physiological significance of these unusual response element motifs remained unclear. Evidence for a functional role of these non-classical VDREs in mediating natural vitamin D-dependent transcriptional activation was accumulated through the identification and characterization of two natural inverted palindrome VDREs (Table 2) (42). These elements, identified in the promoter regions of the human calbindin D9k gene and the rat osteocalcin gene both consist of inverted palindromes spaced by nine residues (IP9s) (42). The functional response through the IP9 elements was demonstrated both in the context of the native promoter regions and with chimeric promoters in which one copy of the IP9 binding site was subcloned upstream of an heterologous promoter (42). As previously observed with the synthetic elements, the natural IP9s preferentially bound VDR-RXR heterodimers with high affinity (42); binding of the receptors to the sites allowed transcriptional activation by vitamin D and the transcriptional response was further enhanced by addition of 9-cis retinoic acid (9-cis RA) (42), the RXR ligand (31-33). The authors utilized the response of the IP9 element to both vitamin D and 9-cis RA to reconcile their data with previously published observations: indeed, two groups had previously shown that binding of 9-cis RA to the RXR would destabilize the VDR-RXR heterodimerization and thus blunt the transcriptional response mediated by vitamin D through classical VDREs (30; 43). Schräder et al. (42) found that the response to 9-cis RA is dependent on the VDR to RXR ratio. When the VDR is in excess of the RXR (16:1), concomitant treatment with 9-cis RA inhibited the transcriptional response to vitamin D. On the other hand, excess of RXR molecules relative to VDR (4:1) led to additive effects of treatment with both ligands on the activation of transcription mediated through the IP9 (42). This observation suggests that both the 9-cis RA ligand and the levels of expression of its specific receptor, RXR, play important roles in vitamin D-dependent gene transcription.

GGGGGAtgtgAGGAGA

TGAACTctcaTGAACT

GGGTGActcaccGGGTGA

TGCCCTtccttatggGGTTCA

TGCACTgggtgaatgAGGACA

AGGTGAAAGATGTATGCCAAGACGGGGGTTGAAAG

It should be mentioned that the core binding motifs of characterized VDREs diverge from the consensus motif GGTTCA (Table 1). Similarly, the IP9 elements are imperfect inverted palindromes (42). This variation from the consensus sequence in each 'half-site' of the response elements seems to allow for specific binding polarities of the nuclear receptors; VDR-RXR heterodimers bind their response elements with RXR occupying the 5'-'half-site' while the VDR occupies the 3'-motif (44). The same binding polarity was observed for the IP9 binding elements (42). The polarity-directed binding of the nuclear receptors to their cognate binding site may have implications for the specific cellular response to particular ligands (36).

3.2. In the promoter of the c-fos proto-oncogene

We have been interested in studying the effects of vitamin D treatment on the expression of the members of the fos and jun families of proto-oncogenes in bone cells. c-fos encodes a nuclear phosphoprotein (c-Fos) that heterodimerizes with the members of the jun family of proto-oncogenes to form the transcription factor AP-1, which binds specific sites in the promoter region of target genes to regulate their transcription (reviewed in ref. 45). There is a growing body of experimental evidence demonstrating that the c-fos proto-oncogene plays a key role in the regulation of bone tissue metabolism (46). We have shown that 1,25 (OH)₂D₃ can transiently stimulate the expression of c-fos in osteoblasts and that this stimulation is mediated at the level of gene transcription (47).

We have pursued this work by identifying and characterizing the VDRE in the promoter of c-fos (48). The 1,25 (OH)₂D₃ -responsive region was delineated between residues -178 to -144 upstream of the c-fos transcription start site. Transient transfection assays using wild-type or mutated versions of the c-fos VDRE in the context of natural or chimeric promoters demonstrated that the c-fos VDRE is a functional response element. The structure of the c-fos VDRE was found to be unusual with the following sequence:

When analyzed in the context of the DR-type structures, three putative hexameric core sites can be identified (underlined). These would give the c-fos VDRE either a DR7-like conformation or a DR20-type configuration. However, mutational analysis has revealed that these alignments are not valid (48).

We have not detected homodimeric binding of the VDR to the c-fos VDRE (48). Our data also revealed that VDR-RAR and VDR-T₃R heterodimers do not bind the c-fos VDRE (not shown). Moreover, while both the VDR protein and the RXR molecule were detected in the complex from bone cells that bound the c-fos VDRE, the VDR-RXR heterodimer bound to the element in vitro yielded a complex of a different size than the complex observed in nuclear extracts from bone cells (48). We interpreted these observations to mean that the vitamin D-responsive complex binding the c-fos VDRE in nuclear extracts from bone cells was composed of the VDR and RXR proteins interacting with a third component. Indeed, our data also showed that a putativeosteoblast-specific NF-1 family member bound the response element in conjunction with the nuclear hormone receptors (48). These results will be discussed in more detail in section 4.2 below.

A region showing sequence similarity to the murine c-fos VDRE can be identified in the human c-fos promoter (Fig.1).

-178 AG GTGAAAGATG TATGCCAAGA CGGGGGTTGA AAG -144

        |   | ||      ||||||  ||||||  |   ||

-185 GA GATTAGGACA CGCGCCAAGG CGGGGGCAGG GAG -151

This sequence also binds the VDR and mutations affecting binding to the murine VDRE also inhibit binding to the human sequence (Fig.2). Although, the functionality of the human element remains to be established, these results support the physiological importance of the c-fos VDRE.

Mutated residues are underlined.