[Frontiers in Bioscience E2, 1065-1072, June 1, 2010]
IkappaBalpha regulates Hes1 in osteoclast differentiation and resorption
Li Duan1, 2, Paul de Vos3, Marijke Faas3, Mingwen Fan4, Yijin Ren1
1
TABLE OF CONTENTS
1. ABSTRACT
During osteoclast differentiation and resorption, both NF-kappaB and Notch signalling are activated. This study defines the mechanism about the influence of NFkappaB on Notch. To this end, IkappaBalphaM and Wild-type-IkappaBalpha were transfected into RAW 264.7 cells. The number of cells that differentiated into osteoclasts was quantified. The resorption area was measured. NF-kappaB transcriptional activity was determined by EMSA. Hes1, DC-STAMP and MMP-9 mRNA expression levels were determined by RT-PCR. Hes1 protein expression was determined by western blots. ChIP was used to study binding of IkappaBalpha to the Hes1 promoter. NF-kappaB inactivation inhibited the differentiation and resorption ability of osteoclasts. Compared with Wild-type cells, NF-kappaB inactivation resulted in an up-regulation of Hes1 expression, and a down-regulation of DC-STAMP and MMP-9 expression. Moreover, in response to RANKL, NF-kappaB inactivation resulted in a down-regulation of DC-STAMP and MMP-9 expression compared with Wild-type cells. The Hes1 promoter was detected by ChIP using IkappaBalpha antibody. In conclusion, our data suggest IkappaBalpha regulates Hes1-mediated activity in osteoclast differentiation and resorption, which support a cross-talk between NF-kappaB and Notch in osteoclast activity.
2. INTRODUCTION
The development and continuous remodeling of the skeleton demand a tightly regulated balance between bone-formation and bone-resorption. Although many aspects of the resorptive processes remain elusive, a general understanding is that the osteoclast is the pivotal cell in the degradation of the bone matrix (1). Osteoclasts are derived from hematopoietic myeloid precursors of the monocyte/macrophage lineage and under the control of systemic and local factors produced by supporting cells such as osteoblasts and bone marrow stromal cells. Among these factors, RANKL is the key cytokine that stimulates osteoclast differentitation both in vitro and in vivo (2-4). RANK, the receptor of RANKL, is expressed on the surface of osteoclast progenitor cells. When RANK binds to its ligand, intracellular signals including NF-kappaB are induced, leading to osteoclast formation (5).
NF-kappaB is a transcriptional factor family. It consists of c-Rel, p50, p52, p65 and RelB, which can form various homodimers or heterodimers through a highly conserved N-terminal Rel homology domain. In the cytoplasm of quiescent cells, the dimers bind inhibitory molecules of the IkappaB family. Cell activation by various stimuli including RANKL results in serine phosphorylation and degradation of IkappaB. Subsequently, NF-kappaB dimers translocate into the nucleus and regulate down-stream gene expressions (6-8). Moreover, IkappaBalpha can also shuttle between nucleus and cytoplasm (9, 10), which adds complexity to the system. Although nucleo-cytoplasmic shuttling of IkappaBalpha is important for the termination of NF-kappaB signaling, its physiological effect has not been completely understood. It is possible that IkappaBalpha may have an additional unidentified function. It has been recently demonstrated that TNF-alpha stimulation led to the release of IkappaBalpha and up-regulation of Notch-dependent Hes1 (Hairy and enhancer of split) gene expression in fibroblast 3T3 cells and human embryonic kidney 293T cells (11). Hes1 encodes a basic helix-loop-helix transcription factor that functions as a classical effector of the Notch signaling pathway (12).
Recent findings suggest an important role of Notch in cell-fate determination of haemotopoietic progenitor cells (13). In canonical Notch signaling, binding of transmembrane Notch receptors (N1-N4) by Jagged or Delta ligands results in gamma-secretase-mediated cleavage and release of the Notch intracellular domain, its nuclear translocation and association with the transcriptionalactivator Mastermind, and DNA-binding protein, CSL/RBP-J (14). This heterotrimeric complex induces the expression of Notch target genes, such as Hes1 (12).
As cells are frequently exposed to simultaneous activation of different signaling pathway, a fundamental question is, how different transduction pathways integrate into the final message resulting in a biological response? The aim of the present study was to investigate the possible coordination between the NF-kappaB and the Notch signaling pathway in osteoclast formation and function. Here, we present evidence that the regulation of Hes1 by NF-kappaB occurs via a mechanism that is dependent on the release of IkappaBalpha from the Hes1 promoter in RANKL-induced osteoclast activity. It has important implications for future therapeutic approaches directed against these signaling pathways involved in bone diseases.
3. MATERIALS AND METHODS
3.1. Cell culture, transfection, and infection
RAW 264.7 and 293T cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). RAW 264.7 cells were cultured in RPMI1640 and 10% FBS. 293T cells were cultured in DMEM and 10% FBS. Cells were plated at sub-confluence. P-Retro-on- IkappaBalphaM (phosphorylation defective IkappaBalpha (S32, 36A)) and Wild-type plasmids were transfected into 293T using FuGENE 6 (Roche Applied Science, RocheGmbH, Mannheim, Germany), and virus supernatants were harvested to infect RAW 264.7 cells. Stable sub-clones of Mutant and Wild-type were selected with puromycin.
3.2. Osteoclast formation assays
Mutant and Wild-type cells were plated at a density of 1.3�104/cm2 into chamber slides (Nalge Nunc International, Rochester, New York, USA) in the presence of RANKL (100ng/ml). The medium was changed every 2 days. After 5 days of culture, the cells were fixed and stained using the TRAP staining kit (Sigma-Aldrich, St Louis, MO, USA) according to the manufacturer's instructions. TRAP-positive cells with more than three nuclei were considered to be osteoclast-like cells. The number of osteoclast-like cells was counted under a light microscope.
3.3. Resorption assays
Mutant and Wild-type cells were plated at a density of 1.3�104/cm2 onto Osteoclast Activity Assay Substrate (Osteogenic Core Technologies, Chunan, Choongnam, Korea) and treated with 100 ng/ml RANKL. Medium was changed every 2 days. After 10 days of culture, the plates were washed to remove the cells. The resorption areas on the plates were photographed with a digital camera attached to the microscope and analyzed by the Image Analysis System (Leica, Solms, Germany).
3.4. Real-time PCR
Mutant and Wild-type cells were plated at a density of 1.3�104/cm2 in 60 mm tissue culture dishes in the presence of RANKL (100 ng/ml). After 24 h of incubation, total RNA was extracted using Absolutely RNA Miniprep kit (Stratagene, CA, USA) according to the manufacturer's instructions. cDNA was synthesized with superscript reverse transcriptase (Invitrogen, Nelson, UK), followed by quantitative real time PCR with gene specific primers. Hes1 primers (5-ACCCAGCCAGTGTCAACA-3 and 5-CATTGATAGGCTTTGATGACTTTCTG-3), DC-STAMP primers (5- TTGCCGCTGTGGACTATCTG -3 and 5- GAATGCAGCTCGGTTCAAAC -3), and MMP-9 primers (5-TTCCCCAAAGACCTGAAAACC-3 and 5-GCCCGGGTGTAACCATAGC-3) were designed using Primer Express 2.0 (Applied Biosystems, Foster City, CA, USA). Relative quantities of mRNA expression were analysed using Quantitative RT-PCR (Bio-Rad, CA, USA) in the presence of SYBR green (Applied Biosystems, Foster City, CA, USA). For the normalization of each sample, the expression level of the gene was divided by that of beta-actin.
3.5. Cell extracts preparation and Western blot analysis
Mutant and Wild-type cells were washed twice with ice-cold PBS, scraped and collected by centrifugation. Cell pellets were lysed with cytoplasmic lysis buffer. The tubes were gently vortexed for 15 min. Nuclei were collected by centrifugation at 8000 g for 15 min, and the supernatants were stored at -80 �C. To obtain nuclear protein extracts, the pellets were resuspended in lysis buffer, and gently shaken for 30 min at 4 �C, followed by centrifugation at 13,000 g for 15 min. Protein concentrations of the extracts were determined by using the Bio-Rad protein agent (Bio-Rad, Muchen, Germany). Fifty micrograms of total protein was resolved on a 10% SDS-PAGE gel, transferred to a nitrocellulose membrane, and probed with primary antibody Phospho-NF-kappaB p65 (Ser536) (Cell Signaling Technologies, Beverly, MA, USA) and Hes1 (Santa Cruz Biotech, Santa Cruz, CA, USA). Specific binding was detected using a secondary antibody coupled to horseradish peroxidase and the Lumi-light Plus Western blot substrate (Roche diagnostics GmbH, Munniheim, Germany). After detection, blots were stripped and reprobed with primary antibody beta-actin (Santa Cruz Biotech, Santa Cruz, CA, USA). The bands were quantified by Quantity One software (Bio-Rad, CA, USA).
3.6. Electrophoretic mobility shift assay (EMSA)
Electrophoretic mobility shift assay (EMSA) was performed using NF-kappaB oligonucleotide probe (5-AGTTGAGGGGACTTTCCCAGGC-3) end-labeled with (gamma-32P). Nuclear protein (2 μg) was pre-incubated in binding buffer, consisting of 10 mM Tris-Cl, pH 7.5, 1 mM MgCl2, 50 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 4% glycerol, and 0.05 μg/ml of poly (dI-dC) (deoxyinosinic deoxycytidylic acid) (Amersham Biosciences) for 15 min at room temperature. After addition of the 2 μl (gamma-32P)-labeled oligonuleotide probe, the incubation was continued for 30 min at room temperature. The reaction was terminated by adding 1 μl gel loading buffer, and the mixture was subjected to non-denaturing 4% polyacrylamide gel electrophoresis in 0.5 � TBE buffer. The gel was exposed to X-ray film for 1 h to overnight at -80 �C with an intensifying screen and scanned. The bands were quantified by Quantity One software..
3.7. Chromatin immunoprecipitation (ChIP)
Approximately 2�106 RAW 264.7 cells with or without RANKL stimulation were cross-linked in the presence of 1% formaldehyde for 15 min at room temperature. Cross-linking was stopped on addition of glycine to a final concentration of 125 mM for 5 min at room temperature. Cells were washed twice with cold 1� PBS, scraped, and centrifuged at 100g for 5 min. Cell pellets were resuspended in 400 μl lysis buffer (5 mM Pipes (KOH), pH 8.0, 85 mM KCl, 0.5% NP40, containing complete protease inhibitors) and incubated on ice for 10 min. Nuclei were pelleted in a microcentrifuge at 1500g for 5 min at 4 �C. The nuclei preparations were resuspended in 200 μl nuclear lysis buffer (50 mM Tris, pH8, 10 mM EDTA, pH 8, 1% SDS, complete protease inhibitors) and incubated on ice for 10 min. While on ice, samples were sonicated with 6�20s bursts using a branson sonifier. Debris was cleared by centrifugation at 15,800g for 5 min. The supernatant was transferred to a new tube and diluted 5-fold in chromatin immunoprecipitation (ChIP) dilution buffer (0.01% SDS, 1.1% TritionX 100, 1.2 mM EDTA, 16.7 mM Tris, pH8, 167 mM NaCl including complete protease inhibitors). To reduce nonspecific backgroud, the samples were precleaned with 40 μl protein G sepharose and 20 μg salmon sperm DNA. Twenty percent of the samples were kept as a total input control. Anti- IkappaBalpha antibody or rabbit Ig (10 μg/ml) was used for immunoprecipitation, prearmed with 20 μl protein G sepharose /20 μg salmon sperm DNA slurry overnight at 4 �C. Beads were washed three times in low salt buffer (0.1% SDS, 1.0% TritionX 100, 2 mM EDTA, 20 mM Tris, pH8, 150 mM NaCl) for 10 min at 4�C and three times with high salt buffer (0.1% SDS, 1.0% TritionX 100, 2 mM EDTA, 20 mM Tris, pH8, 500 mM NaCl). Cross-linkage was reversed by heating at 65�C, followed by treatment with 40 μg/ml proteinase K at 45 �C for 60min. DNA was recovered by phenol-chlorophorm-ethanol precipitation and used as a template for PCR to amplify the region including the IkappaBalpha site in the Hes1 promoter. Primers for input and sample preparations: Forward 5'- TTCCTCCCATTGGCTGAAAG-3'; Reverse 5'-GTGATCGGTAGCACTATTCC-3' (195bp, NC000082). PCR amplification was achieved at 94�C/30s; 58�C/30s and 72�C/30s for 25 cycles. The PCR products were electrophoresed on a 1% agrose gel and stained with ethidium bromide.
3.8. Data analysis
Data were expressed as mean +/- SD. Statistical differences were determined using ANOVA or student's t test for repeated measures; p <0.05 was considered to be significant.
4. RESULTS
4.1. Stable expression of IkappaBalphaM in RAW 264.7 cells
To profile the extent of IkappaBalphaM expression in RAW 264.7 cells used for the present studies, we selected several subclones stably expressing exogenous IkappaBalphaM (Mutant cells), as well as several RAW 264.7 subclones stably expressing the IkappaBalpha gene (Wild-type cells), transfected with IkappaBalpha vectors, as a control. NF-kappaB DNA binding activity was detected with EMSA. First, the NF-kappaB probe specificity was tested with competitive analysis (Figure 1A). Shift bands decreased with increasing amount of unlabelled NF-kappaB while no change of shift band with addition of noncompetitive SP1 probe. EMSA results show that RANKL increased amounts of nuclear complex protein of NF-kappaB in Wild-type cells compared with Mutant cells (Figure 1B, 1C). A 2.1-fold decrease in the level of p65 nulcear protein was observed in Mutant cells (Figure 1D, 1E), whereas positive, but relatively higer level, of p65 nulcear protein was expressed in control cells (Wild-type cells). EMSA and Western blot results demonstrated that NF-kappaB signaling has been inactivated after IkappaBalphaM vector transfected into RAW 264.7 cells.
4.2. NF-kappaB mediates RANKL-induced differentiation and resorption
Osteoclasts are multinucleated cells with TRAP-positive staining. TRAP staining showed that osteoclast number increased after treatment with RANKL for 5 days. Osteoclast formation was impaired in Mutant cells compared with Wild-type cells (Figure 2A). These results clearly indicate a role of NF-kappaB in osteoclast differentiation. Bone resorption assays were subsequently carried out for understanding whether the osteoclast-like cells induced by RANKL are active. As shown in the Figure 2C, some pit formation was detectable in the cultures of Mutant cells. However, the number and the size of pits formed were further augmented in the cultures of Wild-type cells when these cells were incubated at the same conditions (Figure 2B). Resorption assay results showed the resorption activity of RAW 264.7 cells induced by RANKL was significantly inhibited after NF-kappaB inactivation (Figure 2D).
4.3. NF-kappaB inactivation down-regulates MMP-9 and DC-STAMP expression
MMP-9 and DC-STAMP are target genes of NF-kappaB signaling. In the absence of stimuli, RT-PCR results demonstrated that MMP-9 and DC-STAMP expression was down-regulated after NF-kappaB inactivation (Figure 2E). In response to RANKL, RT-PCR results demonstrated that MMP-9 and DC-STAMP expression was down-regulated after NF-kappaB inactivation (Figure 2F).
4.4. NF-kappaB inactivation up-regulates Notch-dependent Hes1 gene expression
Expression of NF-kappaB M in RAW 264.7 cells results in NF-kappaB inactivation. In the absence of stimuli, we detected higher levels of Hes1 mRNA and protein in Mutant cells compared with Wild-type cells (Figure 3A, 3B and 3C). Furthermore, Hes1 mRNA and protein expression was up-regulated after RANKL treatment in Wild-type cells (Figure 3A, 3D and 3E).
4.5. NF-kappaB inactivation exerts a positive effect on the transcriptional activation of the Hes1 promoter
As IkappaBalpha modulates the Hes1 gene expression, we hypothesized that the IkappaBalpha fraction interacts with the repressor elements was directly responsible for Hes1 expression. To test this, ChIP assays were performed to investigate whether IkappaBalpha protein was combined to the promoter region of this gene. Hes1 promoter was detected from chromatin precipitated with IkappaBalpha antibody, thus indicating that this promoter is indeed able to bind IkappaBalpha. As a control, Hes1 promoter could not be amplified from precipitates with nonrelevant immunoglobulins or with RANKL treatment (Figure 4A, 4B). These observations strongly support that chromatin-associated IkappaBalpha is involved in the recruitment of specific repression complexes in the noninduced state, and RANKL regulates Hes1 transcriptional activation by modulating the association of IkappaBalpha with the Hes1 promoter.
5. DISCUSSION
It is well established that RANKL regulates osteoclast differentiation and resorption mainly via NF-kappaB signaling (15). Our results further confirmed that NF-kappaB signaling is involved in RANKL-induced osteoclast differentiation and resorption. In these processes, NF-kappaB regulates Notch signaling. This is the first study reporting that NF-kappaB influences Notch via the binding of Hes1 promoter in osteoclast activity.
It is generally accepted that NF-kappaB plays an important role in osteoclast formation. TRAP staining is an often-used method to examine osteoclast formation, and TRAP-positive multinucleated cells including osteoclasts or osteoclast-like cells (16, 17). In this study, TRAP-positive multinucleated cells were observed after RANKL-induced NF-kappaB activation, whereas the number of RANKL-induced TRAP-positive multinucleated cells was significantly decreased, after NF-kappaB inactivation by IkappaBalphaM transfection. Studies have demonstrated that RANKL modulates the DC-STAMP expression in osteoclast formation (18) and NF-kappaB binds directly to the DC-STAMP promoter (19). Moreover, MMP-9 plays a crucial role in bone matrix degradation (20) and MMP-9 expression is modulated by RANKL through regulation of NF-kappaB followed by NFAT activation (18). Our study shows that NF-kappaB inactivation results in decreased DC-STAMP and MMP-9 expression as well as bone resorption ability of osteoclasts, thus providing further evidence that NF-kappaB plays a role in osteoclast formation and resorption.
Notch and NF-kappaB pathways are involved in the regulation of gene expression and cellular events in many different systems. The effect of each pathway in inhibiting or promoting differentiation is controversial and it could depend on the cellular context (21-23). Furthermore, Notch and NF-kappaB exert antagonistic or synergistic effects in different system (24, 25). However, the results of this study strongly support the view that NF-kappaB promotes osteoclast differentiation in response to RANKL stimulation. Meanwhile, Notch-dependent Hes1 is up-regulated and the Notch pathway is activated.
Our results demonstrated that recruitment of IkappaBalpha to the Hes1 promoter mediated the process in which NF-kappaB regulates Notch activity. RANKL treatment results in the release of Chromatin-associated IkappaBalpha from the Hes1 promoter, coinciding with the transcriptional activation of this gene. This finding suggested a cross-talk between the NF-kappaB and Notch pathways exists in osteoclasts. Such cross-talk may contribute to additional complexity in the regulation of cell behavior. In the immune system, NF-kappaB mediates Jagged1 expression, which can initiate signaling downstream of Notch (26). However, in the 32D myeloid progenitor system, NF-kappaB inhibits Notch-dependent gene Hes1 (27). On the other hand, many cellular processes have been reported in which activation of Notch signaling correlates with the inhibition of the NF-kappaB pathway. Whether Notch activation enhances or inhibits the activity of NF-kappaB in RAW 264.7 cells in response to RANKL awaits confirmation in our future study.
In conclusion, this study showed that recruitment of IkappaBalpha to the Hes1 promoter was associated with transcriptional repression, and this mechanism was involved in the osteoclast differentiation and resorption. Our findings may provide important clues to understanding the coordination of Notch and NF-kappaB pathways in controlling osteoclast cellular events, and to modulating the state of bone metabolic diseases.
6. ACKNOWLEDGMENTS
This work was financially supported by the Dutch Organization of Scientific Research (NWO 016.056.171) and European Orthodontics Society (EOS).
7. REFERENCES
1. Takahashi, T., Y. Kuniyasu, M. Toda, N. Sakaguchi, M. Itoh, M. Iwata, J. Shimizu and S. Sakaguchi: Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int Immunol, 10, 1969-1980(1998)
doi:10.1093/intimm/10.12.1969
PMid:9885918
2. Onizuka, S., I. Tawara, J. Shimizu, S. Sakaguchi, T. Fujita and E. Nakayama: Tumor rejection by in vivo administration of anti-CD25 (interleukin-2 receptor alpha) monoclonal antibody. Cancer Res, 59, 3128-3133(1999)
PMid:10397255
3. Sakaguchi, S., N. Sakaguchi, J. Shimizu, S. Yamazaki, T. Sakihama, M. Itoh, Y. Kuniyasu, T. Nomura, M. Toda and T. Takahashi: Immunologic tolerance maintained by CD25+ CD4+ regulatory T cells: their common role in controlling autoimmunity, tumor immunity, and transplantation tolerance. Immunol Rev, 182, 18-32(2001)
doi:10.1034/j.1600-065X.2001.1820102.x
PMid:11722621
4. Shimizu, J., S. Yamazaki and S. Sakaguchi: Induction of tumor immunity by removing CD25+CD4+ T cells: a common basis between tumor immunity and autoimmunity. J Immunol, 163, 5211-5218(1999)
PMid:10553041
5. Kapp, J. A., K. Honjo, L. M. Kapp, K. Goldsmith and R. P. Bucy: Antigen, in the presence of TGF-beta, induces up-regulation of FoxP3gfp+ in CD4+ TCR transgenic T cells that mediate linked suppression of CD8+ T cell responses. J Immunol, 179, 2105-2114(2007)
PMid:17675469
6. Nakamura, K., A. Kitani, I. Fuss, A. Pedersen, N. Harada, H. Nawata and W. Strober: TGF-beta 1 plays an important role in the mechanism of CD4+CD25+ regulatory T cell activity in both humans and mice. J Immunol 172, 834-842(2004)
PMid:14707053
7. Fu, S., N. Zhang, A. C. Yopp, D. Chen, M. Mao, D. Chen, H. Zhang, Y. Ding and J. S. Bromberg: TGF-beta induces Foxp3 + T-regulatory cells from CD4 + CD25 - precursors. Am J Transplant, 4, 1614-27(2004)
doi:10.1111/j.1600-6143.2004.00566.x
PMid:15367216
8. Gondek, D. C., L. F. Lu, S. A. Quezada, S. Sakaguchi and R. J. Noelle: Cutting edge: contact-mediated suppression by CD4+CD25+ regulatory cells involves a granzyme B-dependent, perforin-independent mechanism. J Immunol, 174, 1783-1786(2005)
PMid:15699103
9. Cao, X., S. F. Cai, T. A. Fehniger, J. Song, L. I. Collins, D. R. Piwnica-Worms and T. J. Ley: Granzyme B and perforin are important for regulatory T cell-mediated suppression of tumor clearance. Immunity, 27, 635-646(2007)
doi:10.1016/j.immuni.2007.08.014
PMid:17919943
10. Gondek, D. C., V. Devries, E. C. Nowak, L. F. Lu, K. A. Bennett, Z. A. Scott and R. J. Noelle: Transplantation survival is maintained by granzyme B+ regulatory cells and adaptive regulatory T cells. J Immunol, 181, 4752-4760(2008)
PMid:18802078 PMCid:2572718
11. Oderup, C., L. Cederbom, A. Makowska, C. M. Cilio and F. Ivars: Cytotoxic T lymphocyte antigen-4-dependent down-modulation of costimulatory molecules on dendritic cells in CD4+ CD25+ regulatory T-cell-mediated suppression. Immunology, 118, 240-249(2006)
doi:10.1111/j.1365-2567.2006.02362.x
PMid:16771859 PMCid:1782280
12. Grohmann, U., C. Orabona, F. Fallarino, C. Vacca, F. Calcinaro, A. Falorni, P. Candeloro, M. L. Belladonna, R. Bianchi, M. C. Fioretti and P. Puccetti: CTLA-4-Ig regulates tryptophan catabolism in vivo. Nat Immunol, 3, 1097-1101(2002)
doi:10.1038/ni846
PMid:12368911
13. Bennett, C. L., J. Christie, F. Ramsdell, M. E. Brunkow, P. J. Ferguson, L. Whitesell, T. E. Kelly, F. T. Saulsbury, P. F. Chance and H. D. Ochs: The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat Genet, 27, 20-21(2001)
doi:10.1038/83713
PMid:11137993
14. Gambineri, E., T. R. Torgerson and H. D. Ochs: Immune dysregulation, polyendocrinopathy, enteropathy, and X-linked inheritance (IPEX), a syndrome of systemic autoimmunity caused by mutations of FOXP3, a critical regulator of T-cell homeostasis. Curr Opin Rheumatol, 15, 430-435(2003)
doi:10.1097/00002281-200307000-00010
PMid:12819471
15. Seo, S. J., M. L. Fields, J. L. Buckler, A. J. Reed, L. Mandik-Nayak, S. A. Nish, R. J. Noelle, L. A. Turka, F. D. Finkelman, A. J. Caton and J. Erikson: The impact of T helper and T regulatory cells on the regulation of anti-double-stranded DNA B cells. Immunity, 16, 535-546(2002)
doi:10.1016/S1074-7613(02)00298-4
16. Lim, H. W., P. Hillsamer, A. H. Banham and C. H. Kim: Cutting edge: direct suppression of B cells by CD4+ CD25+ regulatory T cells. J Immunol, 175, 4180-4183(2005)
PMid:16177055
17. Iikuni, N., E. V. Lourenco, B. H. Hahn and A. La Cava: Cutting edge: Regulatory T cells directly suppress B cells in systemic lupus erythematosus. J Immunol, 183, 1518-1522(2009)
doi:10.4049/jimmunol.0901163
PMid:19570829
18. Zhao, D. M., A. M. Thornton, R. J. DiPaolo and E. M. Shevach: Activated CD4+CD25+ T cells selectively kill B lymphocytes. Blood, 107, 3925-3932(2006)
doi:10.1182/blood-2005-11-4502
PMid:16418326 PMCid:1895290
19. Fontenot, J. D., M. A. Gavin and A. Y. Rudensky: Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol, 4, 330-336(2003)
doi:10.1038/ni904
PMid:12612578
20. Seidel, M. G., G. Fritsch, T. Lion, B. Jurgens, A. Heitger, R. Bacchetta, A. Lawitschka, C. Peters, H. Gadner and S. Matthes-Martin: Selective engraftment of donor CD4+25high FOXP3-positive T cells in IPEX syndrome after nonmyeloablative hematopoietic stem cell transplantation. Blood, 113, 5689-5691(2009)
doi:10.1182/blood-2009-02-206359
PMid:19478054
21. Godfrey, V. L., J. E. Wilkinson and L. B. Russell: X-linked lymphoreticular disease in the scurfy (sf) mutant mouse. Am J Pathol, 138, 1379-1387(1991)
PMid:2053595 PMCid:1886400
22. Hu, H., I. Djuretic, M. S. Sundrud and A. Rao: Transcriptional partners in regulatory T cells: Foxp3, Runx and NFAT. Trends Immunol, 28, 329-332(2007)
doi:10.1016/j.it.2007.06.006
PMid:17618833
23. Aarts-Riemens, T., M. E. Emmelot, L. F. Verdonck and T. Mutis: Forced overexpression of either of the two common human Foxp3 isoforms can induce regulatory T cells from CD4(+)CD25(-) cells. Eur J Immunol, 38, 1381-1390(2008)
doi:10.1002/eji.200737590
PMid:18412171
24. Curiel, T. J., G. Coukos, L. Zou, X. Alvarez, P. Cheng, P. Mottram, M. Evdemon-Hogan, J. R. Conejo-Garcia, L. Zhang, M. Burow, Y. Zhu, S. Wei, I. Kryczek, B. Daniel, A. Gordon, L. Myers, A. Lackner, M. L. Disis, K. L. Knutson, L. Chen and W. Zou: Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat Med, 10, 942-949(2004)
doi:10.1038/nm1093
PMid:15322536
25. Ebelt, K., G. Babaryka, B. Frankenberger, C. G. Stief, W. Eisenmenger, T. Kirchner, D. J. Schendel and E. Noessner: Prostate cancer lesions are surrounded by FOXP3+, PD-1+ and B7-H1+ lymphocyte clusters. Eur J Cancer, 45, 1664-1672(2009)
doi:10.1016/j.ejca.2009.02.015
PMid:19318244
26. Salama, P., M. Phillips, F. Grieu, M. Morris, N. Zeps, D. Joseph, C. Platell and B. Iacopetta: Tumor-infiltrating FOXP3+ T regulatory cells show strong prognostic significance in colorectal cancer. J Clin Oncol, 27, 186-192(2009)
doi:10.1200/JCO.2008.18.7229
PMid:19064967
27. Gobert, M., I. Treilleux, N. Bendriss-Vermare, T. Bachelot, S. Goddard-Leon, V. Arfi, C. Biota, A. C. Doffin, I. Durand, D. Olive, S. Perez, N. Pasqual, C. Faure, I. Ray-Coquard, A. Puisieux, C. Caux, J. Y. Blay and C. Menetrier-Caux: Regulatory T cells recruited through CCL22/CCR4 are selectively activated in lymphoid infiltrates surrounding primary breast tumors and lead to an adverse clinical outcome. Cancer Res, 69, 2000-2009(2009)
doi:10.1158/0008-5472.CAN-08-2360
PMid:19244125
28. Olkhanud, P. B., D. Baatar, M. Bodogai, F. Hakim, R. Gress, R. L. Anderson, J. Deng, M. Xu, S. Briest and A. Biragyn: Breast cancer lung metastasis requires expression of chemokine receptor CCR4 and regulatory T cells. Cancer Res, 69, 5996-6004(2009)
doi:10.1158/0008-5472.CAN-08-4619
PMid:19567680
29. Aruga, T., E. Suzuki, S. Saji, S. Horiguchi, K. Horiguchi, S. Sekine, D. Kitagawa, N. Funata, M. Toi, K. Sugihara and K. Kuroi: A low number of tumor-infiltrating FOXP3-positive cells during primary systemic chemotherapy correlates with favorable anti-tumor response in patients with breast cancer. Oncol Rep, 22, 273-278(2009)
PMid:19578766
30. Bohling, S. D. and K. H. Allison: Immunosuppressive regulatory T cells are associated with aggressive breast cancer phenotypes: a potential therapeutic target. Mod Pathol, 21, 1527-1532(2008)
doi:10.1038/modpathol.2008.160
PMid:18820666
31. Perrone, G., P. A. Ruffini, V. Catalano, C. Spino, D. Santini, P. Muretto, C. Spoto, C. Zingaretti, V. Sisti, P. Alessandroni, P. Giordani, A. Cicetti, S. D'Emidio, S. Morini, A. Ruzzo, M. Magnani, G. Tonini, C. Rabitti and F. Graziano: Intratumoural FOXP3-positive regulatory T cells are associated with adverse prognosis in radically resected gastric cancer. Eur J Cancer, 44, 1875-1882(2008)
doi:10.1016/j.ejca.2008.05.017
PMid:18617393
32. Zhou, J., T. Ding, W. Pan, L. Y. Zhu, L. Li and L. Zheng: Increased intratumoral regulatory T cells are related to intratumoral macrophages and poor prognosis in hepatocellular carcinoma patients. Int J Cancer, 125, 1640-1648(2009)
doi:10.1002/ijc.24556
PMid:19569243
33. Gao, Q., S. J. Qiu, J. Fan, J. Zhou, X. Y. Wang, Y. S. Xiao, Y. Xu, Y. W. Li and Z. Y. Tang: Intratumoral balance of regulatory and cytotoxic T cells is associated with prognosis of hepatocellular carcinoma after resection. J Clin Oncol, 25, 2586-2593(2007)
doi:10.1200/JCO.2006.09.4565
PMid:17577038
34. Sato, E., S. H. Olson, J. Ahn, B. Bundy, H. Nishikawa, F. Qian, A. A. Jungbluth, D. Frosina, S. Gnjatic, C. Ambrosone, J. Kepner, T. Odunsi, G. Ritter, S. Lele, Y. T. Chen, H. Ohtani, L. J. Old and K. Odunsi: Intraepithelial CD8+ tumor-infiltrating lymphocytes and a high CD8+/regulatory T cell ratio are associated with favorable prognosis in ovarian cancer. Proc Natl Acad Sci USA, 102, 18538-18543(2005)
doi:10.1073/pnas.0509182102
PMid:16344461 PMCid:1311741
35. Sinicrope, F. A., R. L. Rego, S. M. Ansell, K. L. Knutson, N. R. Foster and D. J. Sargent: A Low Intraepithelial Effector (CD3(+))/Regulatory (FoxP3(+)) T-Cell Ratio Predicts Adverse Outcome of Human Colon Carcinoma. Gastroenterology, 137, 1270-1279(2009)
doi:10.1053/j.gastro.2009.06.053
PMid:19577568
36. Beyer, M. and J. L. Schultze: Regulatory T cells in cancer. Blood, 108, 804-811(2006)
doi:10.1182/blood-2006-02-002774
PMid:16861339
37. Dannull, J., Z. Su, D. Rizzieri, B. K. Yang, D. Coleman, D. Yancey, A. Zhang, P. Dahm, N. Chao, E. Gilboa and J. Vieweg: Enhancement of vaccine-mediated antitumor immunity in cancer patients after depletion of regulatory T cells. J Clin Invest, 115, 3623-3633(2005)
doi:10.1172/JCI25947
PMid:16308572 PMCid:1288834
38. Dave, S. S., G. Wright, B. Tan, A. Rosenwald, R. D. Gascoyne, W. C. Chan, R. I. Fisher, R. M. Braziel, L. M. Rimsza, T. M. Grogan, T. P. Miller, M. LeBlanc, T. C. Greiner, D. D. Weisenburger, J. C. Lynch, J. Vose, J. O. Armitage, E. B. Smeland, S. Kvaloy, H. Holte, J. Delabie, J. M. Connors, P. M. Lansdorp, Q. Ouyang, T. A. Lister, A. J. Davies, A. J. Norton, H. K. Muller-Hermelink, G. Ott, E. Campo, E. Montserrat, W. H. Wilson, E. S. Jaffe, R. Simon, L. Yang, J. Powell, H. Zhao, N. Goldschmidt, M. Chiorazzi and L. M. Staudt: Prediction of survival in follicular lymphoma based on molecular features of tumor-infiltrating immune cells. N Engl J Med, 351, 2159-2169(2004)
doi:10.1056/NEJMoa041869
PMid:15548776
39. Kelley, T., R. Beck, A. Absi, T. Jin, B. Pohlman and E. Hsi: Biologic predictors in follicular lymphoma: importance of markers of immune response. Leuk Lymphoma, 48, 2403-2411(2007)
doi:10.1080/10428190701665954
PMid:18067016
40. Farinha, P., H. Masoudi, B. F. Skinnider, K. Shumansky, J. J. Spinelli, K. Gill, R. Klasa, N. Voss, J. M. Connors and R. D. Gascoyne: Analysis of multiple biomarkers shows that lymphoma-associated macrophage (LAM) content is an independent predictor of survival in follicular lymphoma (FL). Blood, 106, 2169-2174(2005)
doi:10.1182/blood-2005-04-1565
PMid:15933054
41. Canioni, D., G. Salles, N. Mounier, N. Brousse, M. Keuppens, F. Morchhauser, T. Lamy, A. Sonet, M. C. Rousselet, C. Foussard and L. Xerri: High numbers of tumor-associated macrophages have an adverse prognostic value that can be circumvented by rituximab in patients with follicular lymphoma enrolled onto the GELA-GOELAMS FL-2000 trial. J Clin Oncol, 26, 440-446(2008)
doi:10.1200/JCO.2007.12.8298
PMid:18086798
42. Byers, R. J., E. Sakhinia, P. Joseph, C. Glennie, J. A. Hoyland, L. P. Menasce, J. A. Radford and T. Illidge: Clinical quantitation of immune signature in follicular lymphoma by RT-PCR-based gene expression profiling. Blood, 111, 4764-4770(2008)
doi:10.1182/blood-2007-10-115915
PMid:18174380
43. Carreras, J., A. Lopez-Guillermo, G. Roncador, N. Villamor, L. Colomo, A. Martinez, R. Hamoudi, W. J. Howat, E. Montserrat and E. Campo: High numbers of tumor-infiltrating programmed cell death 1-positive regulatory lymphocytes are associated with improved overall survival in follicular lymphoma. J Clin Oncol, 27, 1470-1476(2009)
doi:10.1200/JCO.2008.18.0513
PMid:19224853
44. Carreras, J., A. Lopez-Guillermo, B. C. Fox, L. Colomo, A. Martinez, G. Roncador, E. Montserrat, E. Campo and A. H. Banham: High numbers of tumor infiltrating FOXP3-positive regulatory T-cells are associated with improved overall survival in follicular lymphoma. Blood, 108, 2957-2964(2006)
doi:10.1182/blood-2006-04-018218
PMid:16825494
45. Tzankov, A., C. Meier, P. Hirschmann, P. Went, S. A. Pileri and S. Dirnhofer: Correlation of high numbers of intratumoral FOXP3+ regulatory T cells with improved survival in germinal center-like diffuse large B-cell lymphoma, follicular lymphoma and classical Hodgkin's lymphoma. Haematologica, 93, 193-200(2008)
doi:10.3324/haematol.11702
PMid:18223287
46. Lee, A. M., A. J. Clear, M. Calaminici, A. J. Davies, S. Jordan, F. MacDougall, J. Matthews, A. J. Norton, J. G. Gribben, T. A. Lister and L. K. Goff: Number of CD4+ cells and location of forkhead box protein P3-positive cells in diagnostic follicular lymphoma tissue microarrays correlates with outcome. J Clin Oncol, 24, 5052-5059(2006)
doi:10.1200/JCO.2006.06.4642
PMid:17033038
47. Alvaro, T., M. Lejeune, M. T. Salvado, C. Lopez, J. Jaen, R. Bosch and L. E. Pons: Immunohistochemical patterns of reactive microenvironment are associated with clinicobiologic behavior in follicular lymphoma patients. J Clin Oncol, 24, 5350-5357(2006)
doi:10.1200/JCO.2006.06.4766
PMid:17135637
48. Lee, A. M., A. J. Clear, M. Calaminici, A. J. Davies, S. Jordan, F. Macdougall, J. Matthews, A. J. Norton, J. G. Gribben, T. A. Lister and L. K. Goff: Number of CD4+ Cells and Location of Forkhead Box Protein P3-Positive Cells in Diagnostic Follicular Lymphoma Tissue Microarrays Correlates With Outcome. J Clin Oncol, 24, 5052-5059(2006)
doi:10.1200/JCO.2006.06.4642
PMid:17033038
49. de Jong, D., A. Koster, A. Hagenbeek, J. Raemaekers, D. Veldhuizen, S. Heisterkamp, J. P. de Boer and M. van Glabbeke: Impact of the tumor microenvironment on prognosis in follicular lymphoma is dependent on specific treatment protocols. Haematologica, 94, 70-77(2009)
doi:10.3324/haematol.13574
PMid:19059937 PMCid:2625428
50. Farinha, P., A. Al-Tourah, K. Gill, R. Klasa, J. M. Connors and R. D. Gascoyne: The architectural pattern of FOXP3-positive T cells in follicular lymphoma is an independent predictor of survival and histologic transformation. Blood, Nov 9 epub (2009)
51. Schwering, I., A. Brauninger, U. Klein, B. Jungnickel, M. Tinguely, V. Diehl, M. L. Hansmann, R. Dalla-Favera, K. Rajewsky and R. Kuppers: Loss of the B-lineage-specific gene expression program in Hodgkin and Reed-Sternberg cells of Hodgkin lymphoma. Blood, 101, 1505-1512(2003)
doi:10.1182/blood-2002-03-0839
PMid:12393731
52. Kelley, T. W., B. Pohlman, P. Elson and E. D. Hsi: The ratio of FOXP3+ regulatory T cells to granzyme B+ cytotoxic T/NK cells predicts prognosis in classical Hodgkin lymphoma and is independent of bcl-2 and MAL expression. Am J Clin Pathol, 128, 958-965(2007)
doi:10.1309/NB3947K383DJ0LQ2
PMid:18024321
53. Alvaro, T., M. Lejeune, M. T. Salvado, R. Bosch, J. F. Garcia, J. Jaen, A. H. Banham, G. Roncador, C. Montalban and M. A. Piris: Outcome in Hodgkin's lymphoma can be predicted from the presence of accompanying cytotoxic and regulatory T cells. Clin Cancer Res, 11, 1467-1473(2005)
doi:10.1158/1078-0432.CCR-04-1869
PMid:15746048
54. Oudejans, J. J., N. M. Jiwa, J. A. Kummer, G. J. Ossenkoppele, P. van Heerde, J. W. Baars, P. M. Kluin, J. C. Kluin-Nelemans, P. J. van Diest, J. M. Middeldorp and C. J. Meijer: Activated cytotoxic T cells as prognostic marker in Hodgkin's disease. Blood, 89, 1376-1382(1997)
PMid:9028961
55. Muenst, S., S. Hoeller, S. Dirnhofer and A. Tzankov: Increased programmed death-1+ tumor-infiltrating lymphocytes in classical Hodgkin lymphoma substantiate reduced overall survival. Hum Pathol, 40, 1715-1722(2009)
doi:10.1016/j.humpath.2009.03.025
PMid:19695683
56. Schreck, S., D. Friebel, M. Buettner, L. Distel, G. Grabenbauer, L. S. Young and G. Niedobitek: Prognostic impact of tumour-infiltrating Th2 and regulatory T cells in classical Hodgkin lymphoma. Hematol Oncol, 27, 31-39(2009)
doi:10.1002/hon.878
PMid:18924115
57. Yamamoto, R., M. Nishikori, T. Kitawaki, T. Sakai, M. Hishizawa, M. Tashima, T. Kondo, K. Ohmori, M. Kurata, T. Hayashi and T. Uchiyama: PD-1-PD-1 ligand interaction contributes to immunosuppressive microenvironment of Hodgkin lymphoma. Blood, 111, 3220-3224(2008)
doi:10.1182/blood-2007-05-085159
PMid:18203952
58. Alizadeh, A. A., M. B. Eisen, R. E. Davis, C. Ma, I. S. Lossos, A. Rosenwald, J. C. Boldrick, H. Sabet, T. Tran, X. Yu, J. I. Powell, L. Yang, G. E. Marti, T. Moore, J. Hudson, Jr., L. Lu, D. B. Lewis, R. Tibshirani, G. Sherlock, W. C. Chan, T. C. Greiner, D. D. Weisenburger, J. O. Armitage, R. Warnke, R. Levy, W. Wilson, M. R. Grever, J. C. Byrd, D. Botstein, P. O. Brown and L. M. Staudt: Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature, 403, 503-511(2000)
doi:10.1038/35000501
PMid:10676951
59. Hans, C. P., D. D. Weisenburger, T. C. Greiner, R. D. Gascoyne, J. Delabie, G. Ott, H. K. Muller-Hermelink, E. Campo, R. M. Braziel, E. S. Jaffe, Z. Pan, P. Farinha, L. M. Smith, B. Falini, A. H. Banham, A. Rosenwald, L. M. Staudt, J. M. Connors, J. O. Armitage and W. C. Chan: Confirmation of the molecular classification of diffuse large B-cell lymphoma by immunohistochemistry using a tissue microarray. Blood, 103, 275-282(2004)
doi:10.1182/blood-2003-05-1545
PMid:14504078
60. Nyman, H., M. Adde, M. L. Karjalainen-Lindsberg, M. Taskinen, M. Berglund, R. M. Amini, C. Blomqvist, G. Enblad and S. Leppa: Prognostic impact of immunohistochemically defined germinal center phenotype in diffuse large B-cell lymphoma patients treated with immunochemotherapy. Blood, 109, 4930-4935(2007)
doi:10.1182/blood-2006-09-047068
PMid:17299093
61. Hasselblom, S., M. Sigurdadottir, U. Hansson, H. Nilsson-Ehle, B. Ridell and P. O. Andersson: The number of tumour-infiltrating TIA-1+ cytotoxic T cells but not FOXP3+ regulatory T cells predicts outcome in diffuse large B-cell lymphoma. Br J Haematol, 137, 364-373(2007)
doi:10.1111/j.1365-2141.2007.06593.x
PMid:17456059
62. Lee, N. R., E. K. Song, K. Y. Jang, H. N. Choi, W. S. Moon, K. Kwon, J. H. Lee, C. Y. Yim and J. Y. Kwak: Prognostic impact of tumor infiltrating FOXP3 positive regulatory T cells in diffuse large B-cell lymphoma at diagnosis. Leuk Lymphoma, 49, 247-256(2008)
doi:10.1080/10428190701824536
PMid:18231910
63. Saez, A. I., M. Garcia-Cosio, A. J. Saez, J. M. Hernandez, L. Sanchez-Verde, D. Alvarez, P. de la Cueva, R. Arranz, E. Conde, C. Grande, J. Rodriguez, D. Caballero and M. A. Piris: Identification of biological markers of sensitivity to high-clinical-risk-adapted therapy for patients with diffuse large B-cell lymphoma. Leuk Lymphoma, 50, 571-581(2009)
doi:10.1080/10428190902785528
PMid:19373655
64. Gjerdrum, L. M., A. Woetmann, N. Odum, C. M. Burton, K. Rossen, G. L. Skovgaard, L. P. Ryder and E. Ralfkiaer: FOXP3+ regulatory T cells in cutaneous T-cell lymphomas: association with disease stage and survival. Leukemia, 21, 2512-2518(2007)
doi:10.1038/sj.leu.2404913
PMid:17713545
65. Kim, W. Y., Y. K. Jeon, T. M. Kim, J. E. Kim, Y. A. Kim, S. H. Lee, D. W. Kim, D. S. Heo and C. W. Kim: Increased quantity of tumor-infiltrating FOXP3-positive regulatory T cells is an independent predictor for improved clinical outcome in extranodal NK/T-cell lymphoma. Ann Oncol, 20, 1688-1696(2009)
doi:10.1093/annonc/mdp056
PMid:19542249
66. Tiemessen, M. M., T. J. Mitchell, L. Hendry, S. J. Whittaker, L. S. Taams and S. John: Lack of suppressive CD4+CD25+FOXP3+ T cells in advanced stages of primary cutaneous T-cell lymphoma. J Invest Dermatol, 126, 2217-2223(2006)
doi:10.1038/sj.jid.5700371
PMid:16741512 PMCid:2621310
67. Curti, A., S. Trabanelli, V. Salvestrini, M. Baccarani and R. M. Lemoli: The role of indoleamine 2,3-dioxygenase in the induction of immune tolerance: focus on hematology. Blood, 113, 2394-2401(2009)
doi:10.1182/blood-2008-07-144485
PMid:19023117
68. Curti, A., S. Pandolfi, B. Valzasina, M. Aluigi, A. Isidori, E. Ferri, V. Salvestrini, G. Bonanno, S. Rutella, I. Durelli, A. L. Horenstein, F. Fiore, M. Massaia, M. P. Colombo, M. Baccarani and R. M. Lemoli: Modulation of tryptophan catabolism by human leukemic cells results in the conversion of CD25- into CD25+ T regulatory cells. Blood, 109, 2871-2877(2007)
PMid:17164341
69. Corm, S., C. Berthon, M. Imbenotte, V. Biggio, M. Lhermitte, C. Dupont, I. Briche and B. Quesnel: Indoleamine 2,3-dioxygenase activity of acute myeloid leukemia cells can be measured from patients' sera by HPLC and is inducible by IFN-gamma. Leuk Res, 33, 490-494(2009)
doi:10.1016/j.leukres.2008.06.014
PMid:18639339
70. Chamuleau, M. E., A. A. van de Loosdrecht, C. J. Hess, J. J. Janssen, A. Zevenbergen, R. Delwel, P. J. Valk, B. Lowenberg and G. J. Ossenkoppele: High INDO (indoleamine 2,3-dioxygenase) mRNA level in blasts of acute myeloid leukemic patients predicts poor clinical outcome. Haematologica, 93, 1894-1898(2008)
doi:10.3324/haematol.13112
71. Chung, D. J., M. Rossi, E. Romano, J. Ghith, J. Yuan, D. H. Munn and J. W. Young: Indoleamine 2,3-dioxygenase-expressing mature human monocyte-derived dendritic cells expand potent autologous regulatory T cells. Blood, 114, 555-563(2009)
doi:10.1182/blood-2008-11-191197
PMid:19465693
72. Okamoto, A., T. Nikaido, K. Ochiai, S. Takakura, M. Saito, Y. Aoki, N. Ishii, N. Yanaihara, K. Yamada, O. Takikawa, R. Kawaguchi, S. Isonishi, T. Tanaka and M. Urashima: Indoleamine 2,3-dioxygenase serves as a marker of poor prognosis in gene expression profiles of serous ovarian cancer cells. Clin Cancer Res, 11, 6030-6039(2005)
doi:10.1158/1078-0432.CCR-04-2671
PMid:16115948
73. Brandacher, G., A. Perathoner, R. Ladurner, S. Schneeberger, P. Obrist, C. Winkler, E. R. Werner, G. Werner-Felmayer, H. G. Weiss, G. Gobel, R. Margreiter, A. Konigsrainer, D. Fuchs and A. Amberger: Prognostic value of indoleamine 2,3-dioxygenase expression in colorectal cancer: effect on tumor-infiltrating T cells. Clin Cancer Res, 12, 1144-1151(2006)
doi:10.1158/1078-0432.CCR-05-1966
PMid:16489067
74. Caligaris-Cappio, F. and P. Ghia: Novel insights in chronic lymphocytic leukemia: are we getting closer to understanding the pathogenesis of the disease? J Clin Oncol, 26, 4497-4503(2008)
doi:10.1200/JCO.2007.15.4393
PMid:18662968
75. Lauria, F., R. Foa, V. Mantovani, M. T. Fierro, D. Catovsky and S. Tura: T-cell functional abnormality in B-chronic lymphocytic leukaemia: evidence of a defect of the T-helper subset. Br J Haematol, 54, 277-283(1983)
doi:10.1111/j.1365-2141.1983.tb02096.x
PMid:6221752
76. Foa, R., F. Lauria, P. Lusso, M. C. Giubellino, M. T. Fierro, M. L. Ferrando, D. Raspadori and L. Matera: Discrepancy between phenotypic and functional features of natural killer T-lymphocytes in B-cell chronic lymphocytic leukaemia. Br J Haematol, 58, 509-516(1984)
doi:10.1111/j.1365-2141.1984.tb03998.x
PMid:6333890
77. Beyer, M., M. Kochanek, K. Darabi, A. Popov, M. Jensen, E. Endl, P. A. Knolle, R. K. Thomas, M. von Bergwelt-Baildon, S. Debey, M. Hallek and J. L. Schultze: Reduced frequencies and suppressive function of CD4+CD25hi regulatory T cells in patients with chronic lymphocytic leukemia after therapy with fludarabine. Blood, 106, 2018-2025(2005)
doi:10.1182/blood-2005-02-0642
PMid:15914560
78. Giannopoulos, K., M. Schmitt, M. Kowal, P. Wlasiuk, A. Bojarska-Junak, J. Chen, J. Rolinski and A. Dmoszynska: Characterization of regulatory T cells in patients with B-cell chronic lymphocytic leukemia. Oncol Rep, 20, 677-682(2008)
PMid:18695923
79. Jak, M., R. Mous, E. B. Remmerswaal, R. Spijker, A. Jaspers, A. Yague, E. Eldering, R. A. Van Lier and M. H. Van Oers: Enhanced formation and survival of CD4+ CD25hi Foxp3+ T-cells in chronic lymphocytic leukemia. Leuk Lymphoma, 50, 788-801(2009)
doi:10.1080/10428190902803677
PMid:19452318
80. Ding, W., G. S. Nowakowski, T. R. Knox, J. C. Boysen, M. L. Maas, S. M. Schwager, W. Wu, L. E. Wellik, A. B. Dietz, A. K. Ghosh, C. R. Secreto, K. L. Medina, T. D. Shanafelt, C. S. Zent, T. G. Call and N. E. Kay: Bi-directional activation between mesenchymal stem cells and CLL B-cells: implication for CLL disease progression. Br J Haematol,147, 471-483(2009)
doi:10.1111/j.1365-2141.2009.07868.x
PMid:19751240
81. Hus, I., M. Schmitt, J. Tabarkiewicz, S. Radej, K. Wojas, A. Bojarska-Junak, A. Schmitt, K. Giannopoulos, A. Dmoszynska and J. Rolinski: Vaccination of B-CLL patients with autologous dendritic cells can change the frequency of leukemia antigen-specific CD8+ T cells as well as CD4+CD25+FoxP3+ regulatory T cells toward an antileukemia response. Leukemia, 22, 1007-1017(2008)
doi:10.1038/leu.2008.29
PMid:18323802
82. Giannopoulos, K., A. Dmoszynska, M. Kowal, E. Wasik-Szczepanek, A. Bojarska-Junak, J. Rolinski, H. Dohner, S. Stilgenbauer and L. Bullinger: Thalidomide exerts distinct molecular antileukemic effects and combined thalidomide/fludarabine therapy is clinically effective in high-risk chronic lymphocytic leukemia. Leukemia, 23, 1771-1778(2009)
doi:10.1038/leu.2009.98
PMid:19440214
83. Landgren, O., R. A. Kyle, R. M. Pfeiffer, J. A. Katzmann, N. E. Caporaso, R. B. Hayes, A. Dispenzieri, S. Kumar, R. J. Clark, D. Baris, R. Hoover and S. V. Rajkumar: Monoclonal gammopathy of undetermined significance (MGUS) consistently precedes multiple myeloma: a prospective study. Blood, 113, 5412-5417(2009)
doi:10.1182/blood-2008-12-194241
PMid:19179464
84. Dhodapkar, M. V., J. Krasovsky and K. Olson: T cells from the tumor microenvironment of patients with progressive myeloma can generate strong, tumor-specific cytolytic responses to autologous, tumor-loaded dendritic cells. Proc Natl Acad Sci U S A, 99, 13009-13013(2002)
doi:10.1073/pnas.202491499
PMid:12235374 PMCid:130577
85. Cohen, S., J. Haimovich and N. Hollander: Dendritic cell-based therapeutic vaccination against myeloma: vaccine formulation determines efficacy against light chain myeloma. J Immunol, 182, 1667-1673(2009)
PMid:19155516
86. Prabhala, R. H., P. Neri, J. E. Bae, P. Tassone, M. A. Shammas, C. K. Allam, J. F. Daley, D. Chauhan, E. Blanchard, H. S. Thatte, K. C. Anderson and N. C. Munshi: Dysfunctional T regulatory cells in multiple myeloma. Blood, 107, 301-304(2006)
doi:10.1182/blood-2005-08-3101
PMid:16150935 PMCid:1895365
87. Beyer, M., M. Kochanek, T. Giese, E. Endl, M. R. Weihrauch, P. A. Knolle, S. Classen and J. L. Schultze: In vivo peripheral expansion of naive CD4+CD25high FoxP3+ regulatory T cells in patients with multiple myeloma. Blood, 107, 3940-3949(2006)
doi:10.1182/blood-2005-09-3671
PMid:16410445
88. Feyler, S., M. von Lilienfeld-Toal, S. Jarmin, L. Marles, A. Rawstron, A. J. Ashcroft, R. G. Owen, P. J. Selby and G. Cook: CD4(+)CD25(+)FoxP3(+) regulatory T cells are increased whilst CD3(+)CD4(-)CD8(-)alphabetaTCR(+) Double Negative T cells are decreased in the peripheral blood of patients with multiple myeloma which correlates with disease burden. Br J Haematol, 144, 686-695(2009)
doi:10.1111/j.1365-2141.2008.07530.x
PMid:19133978
89. Atanackovic, D., Y. Cao, T. Luetkens, J. Panse, C. Faltz, J. Arfsten, K. Bartels, C. Wolschke, T. Eiermann, A. R. Zander, B. Fehse, C. Bokemeyer and N. Kroger: CD4+CD25+FOXP3+ T regulatory cells reconstitute and accumulate in the bone marrow of patients with multiple myeloma following allogeneic stem cell transplantation. Haematologica, 93, 423-430(2008)
doi:10.3324/haematol.11897
PMid:18287134
90. Kolb, H. J., C. Schmid, A. J. Barrett and D. J. Schendel: Graft-versus-leukemia reactions in allogeneic chimeras. Blood, 103, 767-776(2004)
doi:10.1182/blood-2003-02-0342
PMid:12958064
91. Bonifazi, F., A. de Vivo, G. Rosti, F. Guilhot, J. Guilhot, E. Trabacchi, R. Hehlmann, A. Hochhaus, P. C. Shepherd, J. L. Steegmann, H. C. Kluin-Nelemans, J. Thaler, B. Simonsson, A. Louwagie, J. Reiffers, F. X. Mahon, E. Montefusco, G. Alimena, J. Hasford, S. Richards, G. Saglio, N. Testoni, G. Martinelli, S. Tura and M. Baccarani: Chronic myeloid leukemia and interferon-alpha: a study of complete cytogenetic responders. Blood, 98, 3074-3081(2001)
doi:10.1182/blood.V98.10.3074
PMid:11698293
92. Fujii, S.: Role of interferon-alpha and clonally expanded T cells in the immunotherapy of chronic myelogenous leukemia. Leuk Lymphoma, 38, 21-38(2000)
PMid:10811445
93. Yang, X. F., C. J. Wu, S. McLaughlin, A. Chillemi, K. S. Wang, C. Canning, E. P. Alyea, P. Kantoff, R. J. Soiffer, G. Dranoff and J. Ritz: CML66, a broadly immunogenic tumor antigen, elicits a humoral immune response associated with remission of chronic myelogenous leukemia. Proc Natl Acad Sci U S A, 98, 7492-7497(2001)
doi:10.1073/pnas.131590998
PMid:11416219 PMCid:34696
94. Yang, X. F., C. J. Wu, L. Chen, E. P. Alyea, C. Canning, P. Kantoff, R. J. Soiffer, G. Dranoff and J. Ritz: CML28 is a broadly immunogenic antigen, which is overexpressed in tumor cells. Cancer Res, 62, 5517-5522(2002)
PMid:12359762
95. Mumprecht, S., C. Schurch, J. Schwaller, M. Solenthaler and A. F. Ochsenbein: Programmed death 1 signaling on chronic myeloid leukemia-specific T cells results in T-cell exhaustion and disease progression. Blood, 114, 1528-1536(2009)
doi:10.1182/blood-2008-09-179697
PMid:19420358
96. Larmonier, N., N. Janikashvili, C. J. LaCasse, C. B. Larmonier, J. Cantrell, E. Situ, T. Lundeen, B. Bonnotte and E. Katsanis: Imatinib mesylate inhibits CD4+ CD25+ regulatory T cell activity and enhances active immunotherapy against BCR-ABL- tumors. J Immunol, 181, 6955-6963(2008)
PMid:18981115 PMCid:2579962
97. Kiladjian, J. J., B. Cassinat, P. Turlure, N. Cambier, M. Roussel, S. Bellucci, M. L. Menot, G. Massonnet, J. L. Dutel, K. Ghomari, P. Rousselot, M. J. Grange, Y. Chait, W. Vainchenker, N. Parquet, L. Abdelkader-Aljassem, J. F. Bernard, J. D. Rain, S. Chevret, C. Chomienne and P. Fenaux: High molecular response rate of polycythemia vera patients treated with pegylated interferon alpha-2a. Blood, 108, 2037-2040(2006)
doi:10.1182/blood-2006-03-009860
PMid:16709929
98. Kiladjian, J. J., B. Cassinat, S. Chevret, P. Turlure, N. Cambier, M. Roussel, S. Bellucci, B. Grandchamp, C. Chomienne and P. Fenaux: Pegylated interferon-alfa-2a induces complete hematologic and molecular responses with low toxicity in polycythemia vera. Blood, 112, 3065-3072(2008)
doi:10.1182/blood-2008-03-143537
PMid:18650451
99. Kordasti, S. Y., W. Ingram, J. Hayden, D. Darling, L. Barber, B. Afzali, G. Lombardi, M. W. Wlodarski, J. P. Maciejewski, F. Farzaneh and G. J. Mufti: CD4+CD25high Foxp3+ regulatory T cells in myelodysplastic syndrome (MDS). Blood, 110, 847-850(2007)
doi:10.1182/blood-2007-01-067546
PMid:17412885
100. Solomou, E. E., K. Rezvani, S. Mielke, D. Malide, K. Keyvanfar, V. Visconte, S. Kajigaya, A. J. Barrett and N. S. Young: Deficient CD4+ CD25+ FOXP3+ T regulatory cells in acquired aplastic anemia. Blood, 110, 1603-1606(2007)
doi:10.1182/blood-2007-01-066258
PMid:17463169 PMCid:1975843
Abbreviations: NF-kappaB: nuclear factor kappa B; RANKL: nuclear factor kappa B ligand; IkappaBalpha: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; Hes1: hairy and enhancer of split; DC-STAMP: dendritic cell-specific transmembrane protein; MMP-9: matrix metalloproteinase-9; CSL: Delta/Serrate/LAG-2; RBP-J: recombining binding protein suppressor of hairless; EMSA: electrophoretic mobility shift assay; ChIP: chromatin immunoprecipitation; RT-PCR: real-time polymerase chain reaction; TRAP: tartrate resistant acid phosphatase
Key Words: Osteoclast, IkappaBalpha, Hes1, NF-kappaB, Notch
Send correspondence to: Yijin Ren, Department of Orthodontics, University Medical Center Groningen, University of Groningen, Triade gebouw Ingang 24, Hanzeplein 1, 9700 RB Groningen, The Netherlands, Tel: 31-50-3610050, Fax: 31-50-3919150, E-mail:y.ren@dmo.umcg.nl