[Frontiers in Bioscience E3, 240-249, January 1, 2011]
DNA methyltransferase inhibitor CDA-2 synergizes with high-dose thiotepa and paclitaxel in killing breast cancer stem cells
Zhihao Lu1, Jun Jia1, Lijun Di1, Guohong Song1, Yanhua Yuan1, Bo Ma1, Jing Yu1, Yulin Zhu1, Xiaoli Wang1, Xinna Zhou1, Jun Ren1
1
TABLE CONTENT
1. ABSTRACT
It has been suggested that breast cancer stem cells (CSCs), which characterized by CD44+CD24-/low, may result in treatment failure in patients with breast cancer. It is possible therefore that that inhibiting such subpopulation might subsequently improve clinical outcome. In the present study, we found that the CD44+/CD24-/low CSCs, isolated from both human breast cell line MCF-7 and MDA-MB-231, were more resistant to thiotepa, paclitaxel and anthracycline, when compared with the non-breast cancer stem cell subset from the same cell lines, whereas the chemosensitivities were remarkably reversed by higher concentration of thiotepa and paclitaxel except for adriamycin. The percentage of CSCs was significantly decreased with an addition of DNA methyltransferase inhibitor CDA-2 and the expression of Smo, Shh, and Gli-1 of Hedgehog signaling pathway in CSCs was decreased. Of important findings, combination of thiotepa or paclitaxel with CDA-2 could significantly inhibit the proliferation of CSCs regardless of their dosages. These results unveiled that the selection of cytotoxic agents and increasing their dosage might be of great importance in the respect of eliminating CSCs. DNA methyltransferase inhibitor CDA-2 exhibited a synergistic effect with cytotoxic drugs, which might provide a conceptually new therapeutic strategy.
2. INTRODUCTION
Breast cancer is the most common female malignancy and is the leading cause of cancer-associated mortality in women resulted from metastasis or recurrence (1). Despite of advances in treatment, the prognosis of metastatic breast cancer remains poor.
It has been shown that cancer cells in a tumor mass are heterogeneous and only a small subpopulation of cancer cells possesses the ability to proliferate and to be capable of self-renewal. This tumorigenic subpopulation has been called as cancer stem cells (CSCs) or tumor initiating cells (TICs) (2). This subpopulation of CSCs have been identified from some certain tumors such as brain glioma (3), breast cancer (4), prostate cancer (5), melanoma (6) etc.
Breast cancer CSCs, which are characterized by CD44+/CD24-/low, has been isolated from both surgical specimens and breast cancer cell lines, and could be propagated in vitro as nonadherent mammospheres (4,7). Recent studies have demonstrated a correlation of CSCs with disease recurrence, metastasis, drug resistance and poor prognosis (8-10). It has been argued that therapies targeting both the proliferating cells and CSCs would be more effective and improve the treatment of breast cancer. Potential ways to eradiate breast cancer CSCs include immune modulation, blocking the key molecules of stem cell proliferation signaling pathway, cells differentiation treatment (11,12).
Cells differentiation therapies have been regarded as the landmark progress in some malignances since it aims to at differentiating primary initial cells into relatively different normal cells (13). One of the samples of the differentiation therapies is the use of retinoid acid and its analogues which could invert the malignant progression of acute premyelocytic leukemia. In additional to retinoid acid, histone deacetylase inhibitor and human urine extract CDA-2 were also subsequently regarded as cell differentiation agents (14-16). CDA-2 is an inhibitor of DNA methyltransferase, which could suppress tumors through activating tumor suppressor genes, turning on or off genes of certain key signaling regulators via demethylation of their promoter sequences (16-18). Previous studies have unveiled that CDA-2 has shown activities of inhibiting cell proliferation and apoptosis of leukemia, breast cancer, endometrial carcinoma, gastric cancer (19-22). However, it is remains unclear whether CDA-2 may act on CSCs.
The role of high-dose chemotherapy (HDC) with autologous hematopoietic stem cell transplantation in breast cancer has been debated for decades until recently when randomized clinical trials revealed that HDC could significantly prolonged progression-free survival (PFS), and bring marginal benefit to overall survival (OS) of whole population. Interestingly, both PFS and OS were improved dramatically in one of important family, namely triple-negative breast cancer (estrogen receptor (ER) negative, progesterone receptor (PR) negative, Her2 negative, TNBC) (23-25). TNBC is currently assimilated to basal-like breast cancer because of their frequent immunohistochemical negativity for hormone and ERBB2 receptors. Furthermore, Basal-like breast cancer has been shown to have plentiful of CD44+/CD24-/low initial cells, which perhaps makes TNBC an ideal therapeutic model for those patients with refractory or metastatic disease(26,27). To date, little is known whether killing or inhibiting breast cancer CSCs could become a conceptually new therapeutic strategy for metastatic breast cancer (MBC).
We proposed that HDC is a useful method in eliminating breast cancer initial cells or CSCs. In this study, we isolated breast cancer CSCs from MCF-7 and MDA-MB-231 breast cancer cell lines and explored the potential inhibition effects of CSCs to CDA-2 and cytotoxic agents at different concentration. We further analyzed the mRNA expression of down stream molecules of sonic hedgehog signaling pathway (SHH) in CSCs and present evidence here that HDC is a conceptually novel therapeutic strategy for MBC.
3. MATERIALS and METHODS
3.1. Cell lines and Cell culture
Human breast cancer cell lines MCF-7 and MDA-MB-231 was obtained from cell culture center of Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (Beijing, China). MCF-7 cells were cultured with Dulbecco's Modified Eagle's Medium-high Glucose (DMEM, Invitrogen/Gibco, USA) medium, supplemented with 10% heat-inactivated fetal calf serum(FCS, Invitrogen/Gibco, USA) at 37℃ in a humidified atmosphere (5% CO2). MDA-MB-231 cells were cultured with Leibovitz's L-15 (Invitrogen/Gibco, USA) medium, supplemented with 10% FCS at 37℃ in a humidified atmosphere (100% air). Cells were routinely maintained in 75 cm2 tissue culture flasks (Corning, USA) and harvested by 0.05% trypsin/0.025% EDTA (Invitrogen/Gibco, USA) treatment when they were in logarithmic phase of growth for Flow cytometry analysis or drug sensitivity assay.
CDA-2 was purchased from Hefei Everlife Pharmaceutical Co. Ltd. (Anhui, China). CDA-2 was added to cells 24 hours after seeding which include the following treatment: negative control, 1mg/ml, 2mg/ml, 3mg/ml, and 4mg/ml. Medium in each culture flask (Corning; USA) was adjusted to same hydrogen ion concentration and environment. PE labeled anti-human CD44 antibody and FITC labeled anti-human CD24 antibody or their respective isotope controls were from BD Pharmingen (San Diego, CA, USA). The percentage of CSCs was analyzed on Flow cytometry a MoFlo High-performance cell sorter (FortCollins, Florida, USA).
3.2. ATP Bioluminescence Assay
The sorted CD44+/CD24-/low breast CSCs and non-breast CSCs were immediately incubated in polypropylene round-bottom 96-well plates(Corning, USA) at a concentration of 1�103 cells per well. Cytotoxic agents, paclitaxel, adriamycin, and thiotepa, were purchased from Sanofi-aventis, Pfizer and Xudong Haipu (Shanghai, China) respectively. Concentrations of CDA-2 were set as 0.25mg/ml, 0.5mg/ml, 1mg/ml, 2mg/ml, 4mg/ml, and 8mg/ml. Chemotherapeutic compounds were at six different dilutions (25-800%) of the test drug concentrations (TDC/Cmax). The 100% TDC of paclitaxel (PTX), adriamycin (ADM) and thiotepa (PSTA) were 10ug/ml, 1ug/ml and 10ug/ml, respectively. Cultured cells without any drugs were set as negative control (M0), while blank media without tumor cells were positive control (M1). The individual TDC for each cytotoxic drug was predetermined by reference to the published pharmacokinetic and response data. The light output corresponding to the level of ATP present was measured in a luminometer (BHP9504-02, HAMAMATSU, Beijing, China). Data was transferred automatically to an Excel spreadsheet where the inhibitory rate achieved at each tested concentration was calculated by the equation: (test-M1) / {100(M0-M1)}.
3.3. Detection the Activity of Hh Pathway by RT-PCR Method
Total RNA of sorted cells was extracted using Trizol reagent (Invitrogen-life Technology) according to standard protocol. mRNA of Smo, Ptch, Shh, and Gli-1 were amplified using the HotStarTaq® kit according to the manufacturer's instructions. Primers specific to each gene of interest were synthesized (GAPDH: sense GTCAACGGATTTGGTCGTATT, antisense AGTCCTCTGGGTGGCAGTGAT; Ptch: sense GGTGGCACAGTCAAGAACA, antisense ACCAAGAGCGAGAAATGG; Shh: sense ACCGAGGGCTGGGACGAAGA, antisense GGAAAGTGAGGAAGTCGCTG; GIL-1: sense GGGTTACATACCTGTCCTTC, antisense CTCAACAGGAGCTACTGTGG; Smo: sense CACCTCCAATGAGACTCTGTCC, antisense CTCAGCCTGGTTGAAGAAGTCG). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers were set to normalize cDNAs and PCR conditions were optimized for the transcripts to remain in the linear amplification range of the reaction. PCR products were analyzed on a 2% agarose gel and semi-quantitative analysis was performed with Labworks and Image J (NIH image). To reduce sources of variability that may be introduced between different PCR runs, comparative RT-PCR was carried out with each experimental group to be analyzed run in triplicate, normalized to an internal control gene (GAPDH) on the same plate.
3.4. Statistical Analysis
The statistical analyses were conducted with SPSS software (version 15.0). All probabilities were two tailed, with a P value less than 0.05 considered statistically significant (non-parametric test).
4. RESULTS
4.1. CD44+/ CD24-/low CSCs in MCF-7 and MDA-MB-231 Cell Lines
The mean percentage of CD44+/ CD24-/low CSCs from MCF-7 and MDA-MB-231 were 1.70�1.43% and 94.2�1.2% respectively (Figure 1).
4.2. CDA-2 Inhibiting Proliferation of CD44+/CD24-/low CSCs
Breast cancer cells of MCF-7 and MDA-MB-231 were incubated with CDA-2 of increased concentration of 0 mg/ml, 1 mg/ml, 2 mg/ml, 3 mg/ml to 4mg/ml. The percentage of CD44+/ CD24-/low CSCs were significantly reduced from 1.70�1.43%, 0.74�0.42%, 0.49�0.28%, 0.35�0.16%, to 0.18�0.06% in MCF-7 cells (P=0.011). The similar phenomena was also observed in MDA-MB-231 cells and the percentage of CD44+/ CD24-/low CSCs decreased from 94.2�1.2%, 72.2�8.1%, 46.6�0.0%, 6.8�3.9%, to 2.9�1.0% (P=0.01) (Figure 2) .
When CD44+/CD24-/low CSCs isolated from MCF-7 and MDA-MB-231 were cultured with CDA-2 of increased concentration from 0.25mg/ml, 0.5 mg/ml, 1 mg/ml, 2 mg/ml, 4 mg/ml to 8mg/ml for 72h, the proliferation of CD44+/CD24-/low CSCs was significant inhibited and exhibited a dose-dependent elimination. (Figure 2).
4.3. CDA-2 Down-regulating Activity of SHH Pathway
As shown in figure 3, the mRNA expression of SHH and GIi-1 were over-expressed in CD44+/CD24-/low CSCs while they was not expressed in NCSCs of both MCF-7 and MDA-MB-231 cell lines. Ptch was not expressed in any subpopulations of both cell lines, while Smo was only expressed in CD44+/CD24-/low CSCs subpopulation of MCF-7 cell line.
After incubated with CDA-2 at a concentration of 1 mg/ml, the mRNA expression of SHH, GIi-1 and Smo in CD44+/CD24-/low CSCs subpopulation of both MCF-7 and MDA-MB-231 cell lines were significantly decreased, indicating that CDA-2 may inhibit proliferation of CSCs by down-regulating the activity of SHH signaling pathway. (Figure 3)
4.4. Higher Concentration Thiotepa and Paclitaxel Except for Anthracycline Inhibiting the Proliferation of CSCs
After exposure to paclitaxel (PTX) at less than 200% Cmax concentration, the proliferation rate of CD44+/CD24-/low CSCs subpopulation was markedly higher than that of NCSCs subpopulation in both MCF-7 (P=0.026) and MDA-MB-231 cell lines (P=0.01). However, when treated with higher concentrations of paclitaxel (>200% Cmax), CD44+/CD24-/low CSCs could restored sensitivity to paclitaxel in both cell lines and were almost completely eliminated in MCF-7 cell line (Figure 4A).
For the situation of the anthracycline, adriamycin (ADM), CD44+/CD24-/low CSCs exhibited similar resistance at lower concentration of less 200% Cmax compared with that of NCSCs in both MCF-7 (P=0.01)and MDA-MB-231 cell lines (p=0.002). To be much surprised, when the concentration of adriamycin increased to 400% or 800% Cmax, the proliferation rates of both CSCs and NCSCs significantly rebounded with the contrary to paclitaxel and thiotepa.(Figure 4B).
As for thiotepa (PSTA), the proliferation rate of CD44+/CD24-/low CSCs subpopulation was also significantly higher than that of NCSCs at concentration less 200% Cmax in both MCF-7 (P=0.005) and MDA-MB-231 cell line (P=0.002). Similarly, the sensitivity of CD44+/CD24-/low CSCs to thiotepa could be recovered at higher concentrations (>200% Cmax), The proliferation rates of CSCs were remarkably reduced in both cell lines and nearly 100% inhibited in MDA-MB-231 cell line (Figure 4C).
4.5. CDA-2 Synergized the Activity of Thiotepa and Paclitaxel to Inhibit Proliferation of CSCs
Co-culture experiments of 1mg/ml CDA-2 combined with thiotepa, paclitaxel, and anthracycline respectively at various concentrations (25%, 50%, 100%, 200%, 400%, and 800% of Cmax) could result in reduction of the proliferation rates of CSCs and NCSCs in both MCF-7 and MDA-MB-231 cell lines respectively by ATP-TCA assay.
Encouraging findings supported that the proliferation of CD44+/CD24-/low CSCs subpopulation was dramatically inhibited by CDA-2 combined with thiotepa, paclitaxel and anthracycline regardless of their concentration in both MCF-7 and MDA-MB-231 cell lines. The proliferation rates of CSCs isolated from MCF-7 cells were 20�1.0%, 18�1.0%, 16�1.0%, 22�2.0%, 18�1.0%, and 15�1.0% when treated with 1mg/ml CDA-2 and thiotepa of 25%, 50%, 100%, 200%, 400%, and 800% Cmax respectively, compared with proliferation rates of 145�9.0%, 139�4.0%, 123�11.0%, 111�1.0%, 87�12.0%, and 27�2.0% with thiotepa alone (P=0.000). The similar result was observed in MDA-MB-231 cell line interfered with CDA-2 and thiotepa (P=0.020). CDA-2 combined with anthracycline and paclitaxel also exhibited similar synergistic effects with significant statistic difference (MCF-7: P<0.001, P=0.039; MDA-MB-231: P<0.001, P<0.001). (Figure 5)
5. DISCUSSION
Using different systems, investigators have demonstrated that only a minority of "stem-like cells" in breast cancer is capable of self-renewal and tumorigenesis. Through examining the ability of tumorigenesis of different subpopulations isolated from primary breast cancer or metastatic lesions when transplanted into immunosuppressed NOD/SCID mice, breast cancer stem cells (CSC) were identified by cell surface markers CD44+CD24-/low. (2,4,7) Furthermore, it has also been observation that CSCs are able to be serially passaged, each time generating a stem cell population, as well as the more differentiated non-tumorigenic cells forming the bulk of breast cancer (28).
However, the percentage of breast cancer stem cell subpopulation, identified by cell surface makers, varied largely in different breast cancer cell lines (2,29,30). In our study, the percentage of CD44+/CD24-/low CSC subpopulation were 1.70�1.43% and 94.2�1.2 in MCF-7 and MDA-MB-231 cell lines respectively, which were similar to previous studies (29,30). The large variation of CSCs population identified by cell surface maker raised puzzles to the feature of this subpopulation.
Breast cancer cell lines could be classified into five subtypes: luminal, basal, mesenchymal, ErbB2-positive, and myoepithelial, based on gene expression profiling of them (31-34). MDA-MB-231 cell line comes from mesenchymal group while MCF-7 was luminal group (29,34). As for gene expression profile, basal and mesenchymal cells are similar except for differential expression of 227 genes. Some studies suggested that basal-like or mesenchymal subtype might contained higher percent of primary initial cells (25,26). Therefore, the heterogeneous of breast cancer cell subtype may partially be responsible for the variation of percentage of CSCs subpopulation. Meanwhile, better characterization of specific breast cancer stem cell markers is required for more exactly identifying this subpopulation.
Increased evidences showed that CSCs were more resistant to chemotherapy and radiotherapy, which may shrink the size of the tumor, but their effects are often transient and often fail to improve survival (2,14,30,35,36). Therefore, therapies targeting breast CSCs may be more effective to improve clinical outcome. Targeting signal transduction pathways that controls cancer stem cell proliferation and differentiation might be useful to transform malignancies into benign diseases (11,12). It have been demonstrated that CSCs do not appear to have the hyper proliferation signals activity such as tyrosine kinase, while other stem cell proliferating associated molecular signaling pathways such as Wnt, Hh and Notch may play an important role in the development of CSCs(37,38). The Hedgehog signaling pathway has been implicated in many different kinds of cancers. More recently, studies have revealed the relationship between hedgehog pathway and CSCs in multiple myeloma (39), breast cancer (40) and glioma (41,42). Our results showed that the Hh signaling pathway was active in CSCs of breast cancer accompanied with over-expression of Shh, Smo, and Gli-1, while the expression of these molecules were negative in NCSCs.
Targeting Hh pathway might be a potential treatment for tumors. Cyclopamine, a lily-derived relevant chemical, could inhibit Hh ligand-dependent and independent Hh pathway activation through direct interaction with Smo. It has been demonstrated that cyclopamine could inhibit the proliferation of tumor cells such as breast cancer, pancreas cancer, glioma and lung cancer both in vivo and in vitro (43-45).
As an inhibitor of DNA methyltransferase, CDA-2 has been reported that has remarkable effect of anti-cell-proliferation on tumor cells in vitro and interfering the activity of signaling pathway such as ERK and Akt phosphorylation had been reported (16,17). In this present study, CDA-2 dramatically exhibited anti-tumor activity by inhibiting proliferation of CD44+/CD24-/low CSCs. Meanwhile, the expression of Shh, GIi-1 and Smo of CD44+/CD24-/low CSCs were all significantly down-regulated by CDA-2. Thus, the anti-tumor or differentiation-inducing activity of CDA-2 may through down-regulating the hedgehog signaling pathway in breast cancer CSCs.
High-dose chemotherapy (HDC) has been proved to give significantly prolonged progression-free survival (PFS), while the improvement of over-all survival (OS) were only observed in some certain subgroup such as TNBC. TNBC, which most manifest features of the basal-like histological subset, have many similarities to BRCA1-associated breast cancers. In vitro studies, BRCA1-associated breast cancers have shown extreme sensitivity to the alkylating agent, DNA double-strand breaks, such as those induced by etoposide and cisplatin, whereas resistant to mitotic-spindle poisons, such as taxanes and vincas (46,47). Therefore the selection of sensitivity cytotoxic agents is closely associated with clinical outcome. Previous studies have demonstrated the efficiency of high-dose cytotoxic agents such as alkylating and anthracycline on resistant cancer cells both in vitro and in animal models (48). However it is not known the effects of high-dose cytotoxic agents on CSCs, which possess the same characteristic of multi-drug resistance.
We explored the sensitivity of breast cancer CSCs to three prevalently used anti-breast cancer drugs: paclitaxel, anthracycline, and alkylating agent thiotepa of different concentrations. The results revealed that high-dose alkylating agent and paclitaxel could significantly inhibited the proliferation of CD44+/CD24-/low breast CSCs in both MCF-7 and MDA-MB-231 cell lines, which were primarily resistant to them at low concentrations. However, increasing the dose of anthracycline was failed to restore the sensitivity of breast CSCs. The discordance between drug sensitivity and dosage indicated that the selection of conditioning regimen of HDC may be crucial to clinical outcome.
Be of important findings in our study, combination of CDA-2 and cytotoxic agents exhibited encouraging anti-tumor activity by dramatically inhibiting the proliferation of both CD44+CD24-/low CSCs and non-CSCs regardless of their dosage.
Alkylating agents are frequently used in chemotherapy of breast cancer, which the molecular mechanism were mediating cell death by damaging DNA. Therefore, cellular DNA repair mechanisms can influence their anti-tumor efficacy. It has been demonstrated that DNA methyltransferase such as O(6)-methylguanine-DNA methyltransferase (MGMT), may play an important role in the action of DNA repair (49). Therefore, block the DNA repair induced by alkylating agents might dramatically improve the efficacy (50). Therefore the synergistic effects of DNA methyltransferase inhibitor CDA-2 with alkylating agent thiotepa and paclitaxel may be the interference of DNA repair system of CSCs. CDA-2 might inhibit the activity of some DNA methyltransferase which involved in DNA repair. Furthermore, the inhibition of proliferation-dependant signal transduction pathway such as Hh, Akt and Erk caused by CDA-2 would also resulted in increased frangibility of CSCs to DNA damages caused by cytotoxic agents.
This study revealed that the selection of cytotoxic agents and increasing their dosage might be of great importance in the respect of eliminating CSCs. DNA methyltransferase inhibitor CDA-2 exhibited a synergistic effect with cytotoxic drugs. These results might establish one innovation model that CDA-2 synergized thiotepa and/or paclitaxel for targeting CSCs, which will provide a conceptually new therapeutic strategy for clinical treatment of metastatic breast cancer.
6. ACKNOWLEDGMENTS
Zhihao Lu, Jun Jia contributed equally to this paper. This work was supported by 973 Program of The Ministry of Science and Technology of P.R. China (2009CB521700). We thank Mrs. Du Liying of Flow Cytometry Core Facility of the Peking University for her support in flow cytometric assay. We appreciate Prof. Wen G Jiang of Cardiff University School of Medicine for his review of this manuscript.
7. REFERENCE
1. A Jemal, T Murray, E Ward, A Samuels, RC Tiwari, A Ghafoor, EJ Feuer, MJ Thun: Cancer statistics. CA Cancer J Clin 55, 5-26 (2003)
doi:10.3322/canjclin.53.1.5
PMid:12568441
2. F Yu, H Yao, P Zhu, X Zhang, Q Pan, C Gong, Y Huang, X Hu, F Su, J Lieberman, E Song: Let-7 Regulates Self Renewal and Tumorigenicity of Breast Cancer Cells. Cell 131, 1109-1123 (2007)
PMid:15549107
3. SK Singh, C Hawkins, ID Clarke, JA Squire, J Bayani, T Hide, RM Henkelman, MD Cusimano, PB Dirks: Identification of human brain tumour initiating cells. Nature 432, 396-401 (2004)
doi:10.1038/nature03128
PMid:12629218 PMCid:153034
4. M Al-Hajj, MS Wicha, A Benito-Hernandez, SJ Morrison, MF Clarke: Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci USA 100, 3983-3988 (2003)
doi:10.1073/pnas.0530291100
PMid:16322242
5. AT Collins, PA Berry, C Hyde, MJ Stower, NJ Maitland: Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 65, 10946-10951 (2005)
doi:10.1158/0008-5472.CAN-05-2018
PMid:16230395
6. D Fang, TK Nguyen, K Leishear, R Finko, AN Kulp, S Hotz, PA Van Belle, X Xu, DE Elder, M Herlyn: A tumorigenic subpopulation with stem cell properties in melanomas. Cancer Res 65, 9328-9337 (2005)
doi:10.1158/0008-5472.CAN-05-1343
PMid:15994920
7. D Ponti, A Costa, N Zaffaroni, G Pratesi, G Petrangolini, D Coradini, S Pilotti, MA Pierotti, MG Daidone: Isolation and in vitro propagation of tumorigenic breast cancer cells with stem/progenitor cell properties. Cancer Res 65, 5506-5511 (2005)
doi:10.1158/0008-5472.CAN-05-0626
PMid:17349583
8. M Shipitsin, LL Campbell, P Argani, S Weremowicz, N Bloushtain-Qimron, J Yao, T Nikolskaya, T Serebryiskaya, R Beroukhim, M Hu, MK Halushka, S Sukumar, LM Parker, KS Anderson, LN Harris, JE Garber, AL Richardson, SJ Schnitt, Y Nikolsky, RS Gelman, K Polyak: Molecular definition of breast tumor heterogeneity. Cancer Cell 11, 259-273 (2007)
doi:10.1016/j.ccr.2007.01.013
PMid:17229949
9. R Liu, X Wang, GY Chen, P Dalerba, A Gurney, T Hoey, G Sherlock, J Lewicki, K Shedden, MF Clarke: The prognostic role of a gene signature from tumorigenic breast-cancer cells. N Engl J Med 356, 217-226 (2007)
doi:10.1056/NEJMoa063994
10. JF Gong, LJ Di, J Ren: Phenotype analysis and correlations of breast cancer stem cells with drug-resistant related molecular markers. Cytotherapy 9 (suppl), 215 (2007)
PMid:18539959 PMCid:2789399
11. M Kakarala, MS Wicha: Implications of the cancer stem-cell hypothesis for breast cancer prevention and therapy. J Clin Oncol 26, 2813-2820 (2008)
doi:10.1200/JCO.2008.16.3931
PMid:17728710
12. AH Sims, A Howell, SJ Howell, RB Clarke: Origins of breast cancer subtypes and therapeutic implications. Nat Clin Pract Oncol 4, 516-525 (2007)
doi:10.1038/ncponc0908
PMid:16600978
13. C Massard, E Deutsch, JC Soria: Tumor stem cell-targeted treatment: elimination or differentiation. Ann Oncol 17, 1620-1624 (2006)
doi:10.1093/annonc/mdl074
PMid:15940285 PMCid:1369099
14. A Taddei, D Roche, WA Bickmore, G Almouzni: The effects of histone deacetylase inhibitors on heterochromatin: implications for anticancer therapy? EMBO Rep 6, 520-524 (2005)
doi:10.1038/sj.embor.7400441
15. D Mottet, V Castronovo: Histone deacetylases: target enzymes for cancer therapy. Clin Exp Metastasis 25,183-189 (2008)
doi:10.1007/s10585-007-9131-5
PMid:16296925
16. CJ Yao, GM Lai, CF Chan, YY Yang, FC Liu, SE Chuang : Differentiation of pheochromocytoma PC12 cells induced by human urine extract and the involvement of the extracellular signal-regulated kinase signaling pathway. J Altern Complement Med 11, 903-908 (2005)
doi:10.1089/acm.2005.11.903
PMid:18664328
17. J Huang, M Yang, H Liu, J Jin: Human urine extract CDA-2 induces apoptosis of myelodysplastic syndrome-derived MUTZ-1 cells through the PI3K/Akt signaling pathway in a caspase-3-dependent manner. Acta Pharmacol Sin 29, 951-964 (2008)
doi:10.1111/j.1745-7254.2008.00826.x
18. CL Ming, PL Christine: Methyltransferase inhibitors as excellent differentiation helper inducers for differentiation therapy of cancer. Bulletin Chinese Cancer 11, 166-168 (2002)
19. FY Feng, Q Li, CG Ling, Y Zhang, FZ Qin, HQ Wang, WX Huang, SC Jiao, Q Chen, MZ Li, YZ Zhu, MZ Zhou, J Ren, YT Gao, JP Zhao, RS Zheng, WH Zhao, ZQ Meng, F Li, QZ Zhang, DL Zhao, LY Xu, YQ Zhang, YJ Zhang, ZJ Wang, SQ Liu and MC Liau: Phase III clinical trials of the cell differentiation agent-2 (CDA-2): Therapeutic efficacy on breast cancer, non-small cell lung cancer and primary hepatoma. Chinese J Clin Oncol 2, 706-716 (2008)
doi:10.1007/BF02819536
20. J Chen, QY Zhao, XZ Ma: The inhibitory effect of uroacitide against human gastric cancer cell SGC7901 in vitro. Modern Medicine & Health 1, 2-4 (2008)
21. JP Jia, XY Zhong, CL Lin: The Effect of Uroacitide on the Proliferation and Differentiation of Human Endometrial Carcinoma Cell Line EAC. Chinese J Clin Oncol 5,290-292 (2008)
PMid:18761050
22. J Huang, MYang, H Liu, J Jin: CDA-II, a urinary preparation, induces growth arrest and apoptosis of human leukemia cells through inactivation of nuclear factor-kappaB in a caspase-dependent manner. Food Chem Toxicol 47, 40-49 (2009)
doi:10.1016/j.fct.2008.08.001
23. UA Nitz, S Mohrmann, J Fischer, W Lindemann, WE Berdel, C Jackisch, C Werner, C Ziske, H Kirchner, B Metzner, R Souchon, U Ruffert, G Schütt, A Pollmanns, HJ Schmoll, C Middecke, J Baltzer, I Schrader, H Wiebringhaus, Y Ko, S Rosel, T Schwenzer, P Wernet, A Hinke, HG Bender, M Frick: Comparison of rapidly cycled tandem high-dose chemotherapy plus peripheral-blood stem-cell support versus dose-dense conventional chemotherapy for adjuvant treatment of high-risk breast cancer: results of a multicentre phase III trial. Lancet 366, 1935-1944 (2005)
doi:10.1016/S0140-6736(05)67784-7
PMid:12840088
24. MS Tallman, R Gray, NJ Robert, CF LeMaistre, CK Osborne, WP Vaughan, WJ Gradishar, TM Pisansky, J Fetting, E Paietta, HM Lazarus: Conventional adjuvant chemotherapy with or without high-dose chemotherapy and autologous stem-cell transplantation in high-risk breast cancer. N Engl J Med 349,17-26 (2003)
doi:10.1056/NEJMoa030684
PMid:18174609
25. O Gluz, UA Nitz, N Harbeck, E Ting, R Kates, A Herr, W Lindemann, C Jackisch, WE Berdel, H Kirchner, B Metzner, F Werner, G Schütt, M Frick, C Poremba, R Diallo-Danebrock, S Mohrmann: Triple-negative high-risk breast cancer derives particular benefit from dose intensification of adjuvant chemotherapy: results of WSG AM-01 trial. Ann Oncol 19, 861-70 (2008)
doi:10.1093/annonc/mdm551
PMid:18316557
26. MC Cheang, D Voduc, C Bajdik, S Leung, S McKinney, SK Chia, CM Perou, TO Nielsen: Basal-like breast cancer defined by five biomarkers has superior prognostic value than triple-negative phenotype. Clin Cancer Res 14, 1368-1376 (2008)
doi:10.1158/1078-0432.CCR-07-1658
PMid:18559090 PMCid:2481503
27. G Honeth, P Bendahl, M Ringnér, L Saal, S Gruvberger-Saal, K Lovgren, D Grabau, M Ferno, A Borg, C Hegardt: The CD44+/CD24- phenotype is enriched in basal-like breast tumors. Breast Cancer Res 10, R53 (2008)
doi:10.1186/bcr2108
PMid:15987436 PMCid:1143566
28. S Liu, G Dontu, MS Wicha: Mammary stem cells, self-renewal pathways, and carcinogenesis. Breast Cancer Res 7, 86-95 (2005)
doi:10.1186/bcr1021
PMid:17062128 PMCid:1779499
29. C Sheridan, H Kishimoto, RK Fuchs, S Mehrotra, P Bhat-Nakshatri, CH Turner, R Goulet, S Badve, H Nakshatri: CD44 (+)/CD24 (-) breast cancer cells exhibit enhanced invasive properties: an early step necessary for metastasis. Breast Cancer Res 8, R59 (2006)
doi:10.1186/bcr1610
doi:10.1186/bcr1474
PMid:17179479
30. TM Philips, WH McBride, F Pajonk: The response of CD44+/CD24-/lower breast cancer-initiating cells to radiation. J Natl Cancer Inst 98, 1777-1785 (2006)
doi:10.1093/jnci/djj495
PMid:17910759 PMCid:2242660
31. B Kreike, M van Kouwenhove, H Horlings, B Weigelt, H Peterse, H Bartelink, MJ van de Vijver: Gene expression profiling and histopathological characterization of triple-negative/basal-like breast carcinomas. Breast Cancer Res 9, R65 (2007)
doi:10.1186/bcr1771
PMid:16288205
32. E Charafe-Jauffret, C Ginestier, F Monville, P Finetti, J Adelaide, N Cervera, S Fekairi, L Xerri, J Jacquemier, D Birnbaum, F Bertucci: Gene expression profiling of breast cell lines identifies potential new basal markers. Oncogene 25, 2273-2284 (2006)
doi:10.1038/sj.onc.1209254
PMid:12794751
33. LA Gordon, KT Mulligan, H Maxwell-Jones, M Adams, PA Walker, JL Jones: Breast cell invasive potential relates to the myoepithelial phenotype. Int J Cancer 106, 8-16 (2003)
doi:10.1002/ijc.11172
PMid:17157791 PMCid:2730521
34. R Neve, K Chin, J Fridlyand, J Yeh, F Baehner, T Fevr, L Clark, N Bayani, J Coppe, F Tong: A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell 10, 515-527 (2006)
doi:10.1016/j.ccr.2006.10.008
PMid:15803154
35. M Dean, T Fojo, S Bates: Tumour stem cells and drug resistance. Nat Rev Cancer 5, 275- 284 (2005)
doi:10.1038/nrc1590
PMid:16103873
36. CE Eckfeldt, EM Mendenhall, CM Verfaillie: The molecular repertoire of the 'almighty' stem cell. Nat Rev Mol Cell Biol 6, 726-737 (2005)
doi:10.1038/nrm1713
PMid:17979879
37. M Mimeault, R Hauke, PP Mehta, SK Batra: Recent advances in cancer stem/progenitor cell research: therapeutic implications for overcoming resistance to the most aggressive cancers. J Cell Mol Med 11 981-1011 (2007)
doi:10.1111/j.1582-4934.2007.00088.x
PMid:17355951
38. M Mimeault, SK Batra: Interplay of distinct growth factors during epithelial mesenchymal transition of cancer progenitor cells and molecular targeting as novel cancer therapies. Ann Oncol 18, 1605-1619 (2007)
doi:10.1093/annonc/mdm070
PMid:17360475 PMCid:1805487
39. CD Peacock, Q Wang, GS Gesell, IM Corcoran-Schwartz, E Jones, J Kim, WL Devereux, JT Rhodes, CA Huff, PA Beachy, DN Watkins, W Matsui: Hedgehog signaling maintains a tumor stem cell compartment in multiple myeloma. Proc Natl Acad Sci USA 104, 4048-4053 (2007)
doi:10.1073/pnas.0611682104
PMid:16778178
40. S Liu, G Dontu, ID Mantle, S Patel, N Ahn, KW Jackson, P Suri, MS Wicha: Hedgehog signaling and Bmi-1 regulate selfrenewal of normal and malignant human mammary stem cells. Cancer Res 66, 6063-6071 (2006)
doi:10.1158/0008-5472.CAN-06-0054
PMid:17628016 PMCid:2610257
41. EE Bar, A Chaudhry, A Lin, X Fan, K Schreck, W Matsui, S Piccirillo, AL Vescovi, F DiMeco, A Olivi, CG Eberhart: Cyclopaminemediated hedgehog pathway inhibition depletes stem-like cancer cells in glioblastoma. Stem Cells 25, 2524-2533 (2007)
doi:10.1634/stemcells.2007-0166
PMid:17196391 PMCid:1855204
42. V Clement, P Sanchez, N de Tribolet, I Radovanovic, I Ruiz, A Altaba: Hedgehog-Gli-1 signaling regulates human glioma growth, cancer stem cell self-renewal, and tumorigenicity. Curr Biol 17, 165-172 (2007)
doi:10.1016/j.cub.2006.11.033
doi:10.1016/j.cub.2007.01.024
PMid:18563554
43. X Zhang, N Harrington, RC Moraes, M F Wu, SG Hilsenbeck, MT Lewis : Cyclopamine inhibition of human breast cancer cell growth independent of Smoothened (Smo). Breast Cancer Res Treat 115, 505-521 (2009)
doi:10.1007/s10549-008-0093-3
PMid:18230052
44. G Feldmann, N Habbe, S Dhara, S Bisht, H Alvarez, V Fendrich, R Beaty, M Mullendore, C Karikari, N Bardeesy, MM Ouellette, W Yu, A Maitra: Hedgehog inhibition prolongs survival in a genetically engineered mouse model of pancreatic cancer. Gut 57, 1420-1430 (2008)
PMid:11406561
45. EE Bar, D Stearns: New developments in medulloblastoma treatment: the potential of a cyclopamine-lovastatin combination. Expert Opin Investig Drugs 17, 185-195 (2008)
doi:10.1517/13543784.17.2.185
PMid:14559807
46. ME Moynahan, TY Cui, M Jasin: Homology-directed DNA repair, mitomycin-c resistance, and chromosome stability is restored with correction of a Brca1 mutation. Cancer Res 61, 4842-4850 (2001)
PMid:10544072
47. JE Quinn, RD Kennedy, PB Mullan, PM Gilmore, M Carty, PG Johnston, DP Harkin: BRCA1 functions as a differential modulator of chemotherapy-induced apoptosis. Cancer Res 63, 6221-6228 (2003)
PMid:16777483
48. N Kroger, W Achterrath, S Hegewisch-Becker, K Mross, AR Zander: Current options in treatment of anthracycline-resistant breast cancer. Cancer Treat Rev 25, 279-91 (1999)
doi:10.1053/ctrv.1999.0137
PMid:18632623
49. A Sabharwal, MR Middleton: Exploiting the role of O6-methylguanine-DNA- methyltransferase (MGMT) in cancer therapy. Curr Opin Pharmacol 6, 355-63 (2006)
doi:10.1016/j.coph.2006.03.011
PMid:18083101
50. D Beier, S Rohrl, DR Pillai, S Schwarz, LA Kunz-Schughart, P Leukel, M Proescholdt, A Brawanski, U Bogdahn, A Trampe-Kieslich, B Giebel, J Wischhusen, G Reifenberger, P Hau, CP Beier: Temozolomide preferentially depletes cancer stem cells in glioblastoma. Cancer Res 68, 5706-5715 (2008)
doi:10.1158/0008-5472.CAN-07-6878
PMid:18515410 PMCid:2707354
Key Words: Breast Cancer Stem Cells, Cytotoxic Drug, Hedgehog Signaling Pathway, High-dose Chemotherapy
Send correspondence to: Jun Ren, Department of Medical Oncology, Peking University School of Oncology, Beijing Cancer Hospital & Institute, 52 Fucheng Rd, Beijing100142, China, Tel: 86-10-88196356, Fax: 86-10-88196356, E-mail:renjun@bjcancer.org