[Frontiers in Bioscience E3, 515-528, January 1, 2011]
Sulforaphane synergizes with quercetin to inhibit self-renewal capacity of pancreatic cancer stem cells
Rakesh K. Srivastava1, Su-Ni Tang1, Wenyu Zhu1, Daniel Meeker1, Sharmila Shankar2
1
TABLE OF CONTENTS
1. ABSTRACT
According to the cancer stem cell hypothesis, the aggressive growth and early metastasis of cancer may arise through dysregulation of self-renewal of stem cells. The objectives of this study were to examine the molecular mechanisms by which sulforaphane (SFN, an active compound in cruciferous vegetables) inhibits self-renewal capacity of pancreatic cancer stem cells (CSCs), and synergizes with quercetin, a major polyphenol and flavonoid commonly detected in many fruits and vegetables. Our data demonstrated that SFN inhibited self-renewal capacity of pancreatic CSCs. Inhibition of Nanog by lentiviral-mediated shRNA expression enhanced the inhibitory effects of sulforaphane on self-renewal capacity of CSCs. SFN induced apoptosis by inhibiting the expression of Bcl-2 and XIAP, phosphorylation of FKHR, and activating caspase-3. Moreover, SFN inhibited expression of proteins involved in the epithelial-mesenchymal transition (β-catenin, vimentin, twist-1, and ZEB1), suggesting the blockade of signaling involved in early metastasis. Furthermore, the combination of quercetin with SFN had synergistic effects on self-renewal capacity of pancreatic CSCs. These data suggest that SFN either alone or in combination with quercetin can eliminate cancer stem cell-characteristics.
2. INTRODUCTION
Cancer of the pancreas is the fourth leading cause of cancer death in the United States. This year approximately 32,000 Americans will die from cancer of the pancreas. With an overall 5-year survival rate of 3% (1), pancreatic cancer has one of the poorest prognoses among all cancers (2). Only 20% of pancreatic cancer patients are eligible for surgical resection, which currently remains the only potentially curative therapy (3). Unfortunately, many cancers of the pancreas are not resectable at the time of diagnosis. There are limited treatment options available for this disease because chemo- and radio-therapies are largely ineffective, and metastatic disease frequently redevelops even after surgery (1, 2). Therefore, developing effective strategies to prevent pancreatic neoplasms are of paramount importance.
Pancreatic cancer becomes clinically apparent at late stages and it resists all forms of conventional chemotherapy and radiotherapy (1, 2). Cancer stem cells (CSCs) have been proposed recently to be the cause of chemotherapy failure (4). Therefore, understanding the pathogenesis of the preinvasive stage, and developing effective strategies to prevent and/or treat pancreatic neoplasms are of paramount importance. CSCs and epithelial-mesenchymal transition (EMT)-type cells, which shares molecular characteristics with CSCs, have been believed to play critical roles in drug resistance and early cancer metastasis as demonstrated in several human malignancies including pancreatic cancer. Thus, the discovery of molecular knowledge of drug resistance and metastasis in relation to CSCs and EMT in pancreatic cancer is becoming an important area of research, and such knowledge is likely to be helpful in the discovery of newer drugs as well as designing novel therapeutic strategies for the treatment of pancreatic cancer with better outcome.
An increasing amount of scientific evidence indicates that tumors contain a small number of tumor-forming and self-renewing CSCs within a population of nontumor-forming cancer cells (5). CSCs have recently been identified in several types of human cancers including pancreatic cancer cancer (6-12). It has been suggested that conventional chemotherapies kill differentiated or differentiating cells. These cells form the bulk of the tumor, but are unable to generate new cells. However, CSCs remain untouched, and therefore can cause a relapse of cancer (5). Removal of CSCs becomes more and more crucial to chemo- and radio-therapy. Unlike most cells within the tumor, CSCs, including pancreatic CSCs, are resistant to well-defined chemotherapy and radiotherapy, and may contribute to tumor metastasis and tumor recurrence after treatment (13-16). They can also regenerate all the cell types in the tumor through their stem cell-like behavior. For this reason, drugs that selectively target CSCs offer a greater promise for cancer therapy and prevention.
It is now clear that therapeutic failure/recurrence is due to ineffective targeting of CSC population. The clinical relevance of the cancer stem cell theory, however, has yet to be determined, along with the precise relationship between normal and cancer SCs. CD133 was reported as a marker of cancer stem cells in the brain (17-19), colon (20-22), liver (23, 24) and prostate (25-28). In pancreatic cancer, Li and colleagues have determined that pancreatic cancer is hierarchically organized and originates from a primitive stem/progenitor group of cells for which CD44+CD24+ESA+ precursors constitute one of the most immature stages (9). However, Hermann and colleagues have reported that a distinct subpopulation of CD133+ cancer stem cells determined the metastatic phenotype of individual tumors (29). Based on these studies it appears that, there are two possible sources for cancer stem cells in pancreatic cancer; the first source is CD44+ CD24+ ESA+ cells, and the second source is CD133+ cells. Furthermore, Hermann et al. reported that these 2 populations overlap but are not identical (29). Since CD44 expressed in almost 100% of pancreatic cancer cell lines, it seemed to be an inappropriate marker for isolating pancreatic cancer stem cells or cancer initiating cells. The CD44+CD24+ESA+ pancreatic cancer cells are highly tumorigenic and possess the stem cell-like properties of self-renewal and the ability to produce differentiated progeny (9). Pancreatic cancer stem cells also demonstrate upregulation of molecules important in developmental signaling pathways, including sonic hedgehog (8, 10, 30, 31) and the polycomb gene family member Bmi-1 (8, 10). Of clinical importance, cancer stem cells in several tumor types have shown resistance to standard therapies and may play a role in treatment failure or disease recurrence. Identification of pancreatic cancer stem cells and further elucidation of the signaling pathways that regulate their growth and survival may provide novel therapeutic approaches to treat pancreatic cancer, which is notoriously resistant to standard chemotherapy.
A number of experimental studies have also support that certain dietary chemicals isolated from foodstuffs can protect against cancer. An important group of agents that have this property are the organosulfur compounds such as isothiocyanates (ITCs), abundant in cruciferous vegetables for which consumption has epidemiologically shown an inverse link with pancreatic cancer. ITC have been shown to exhibit several potential chemoprotective activities in cell and animal models (32-38). Epidemiological studies have suggested that increased risks of pancreatic cancer are associated with tobacco, obesity and high consumption of fat, fish, pork or beef, and that decreased risks are associated with consumption of cruciferous vegetables. In human pancreatic cancer cells, it has been reported that benzyl isothiocyanate (BITC) and sulforaphane (SFN) which are abundantly included in garden cress and broccoli, respectively, have anti-proliferative activity (32, 34, 35, 39-41). Oral administration of SFN inhibited or retarded experimental multistage carcinogenesis models including cancers of the breast, colon, stomach, prostate, and lung. Previously, these anticancer effects were attributed to modulation of carcinogen metabolism by the inhibition of metabolic activation of phase I enzymes and the induction of phase II detoxification enzymes and glutathione (GSH) levels (36, 42). Furthermore, we have recently demonstrated that SFN induces death receptors (DR4 and DR5) and proapoptotic members of Bcl-2 family, inhibits antiapoptotic Bcl-2 proteins, activates caspase(s), and enhances apoptosis-inducing potential of TRAIL in vitro (38). In vivo, SFN inhibits growth of PC-3 cells orthotopically implanted in nude mice by inducing apoptosis and inhibiting tumor cell proliferation, metastasis and angiogenesis (38). In a recent report, sulforaphane has been suggested to target pancreatic cancer stem cells (34). These studies strongly suggest that SFN can be developed as a pancreatic cancer preventive and/or therapeutic agent.
Flavonoids represent one of the most actively studied classes of molecules for their potential to prevent cancer. Quercetin, 3, 3′, 4′, 5, 7-pentahydroxylflavone, is a typical flavonol-type flavonoid ubiquitously present in fruits and vegetables, such as onion, tea, apples and berries. It exhibits anti-oxidative, anti-inflammatory and vasodilating effects, and has been proposed to be a potential anti-cancer agent (43). Epidemiological studies have estimated that the daily dietary intake of quercetin by an individual ranges from 4 to 68 mg (44-46). Quercetin exert antitumor activity, inhibit proliferation and induce apoptosis in human pancreatic cancer cells (47-49). Quercetin itself showed growth inhibitory activity on both drug-sensitive and MDR cells (50-52). In addition, quercetin at a non-cytotoxic concentration has enhanced the effect of chemotherapeutic drug on MDR cells. Quercetin has also been shown to act as a chemosensitizer for the ABC pump-proteins in a number of MDR tumor cell lines. Furthermore, quercetin interacts directly with transporter proteins to inhibit drug efflux mediated by either MDR1 or MRP1 or BCRP (53-57).
FOXO subfamily of forkhead transcription factors include FOXO1a / FKHR, FOXO3a / FKHRL1, and FOXO4 / AFX (58-61). The PI3K pathway, via activation of its downstream kinase AKT, phosphorylates each of the FOXO proteins (62-64). These phosphorylations result in impairment of DNA binding ability and increased binding affinity for the 14-3-3 protein (63, 64). Newly formed 14-3-3-FOXO complexes are then exported from the nucleus (65), thereby inhibiting FOXO-dependent transcription. Inhibition of the PI3K pathway leads to dephosphorylation and nuclear translocation of active FKHRL1, FKHR, and AFX; which induce cells cycle arrest and apoptosis (66). Conversely, loss of PTEN activity results in increased AKT activity leading to inhibition of FOXO protein activity through phosphorylation and cytoplasmic sequestration. In addition, the data demonstrate that FOXO transcriptional activity controls cellular proliferation and apoptosis downstream of PTEN (67, 68). FOXO regulates cell cycle and apoptotic genes such as cyclin-dependent kinase inhibitor (CKI) p27KIP1 (65, 67, 69, 70), Bim (71, 72), Fas ligand (63), and Bcl-6 (73). Interestingly, overexpression of AKT, and inactivation and loss of PTEN are frequently observed in pancreatic cancer (74-80), indicating a potential role for FOXOs in modulating both cell cycle and apoptosis during tumorigenesis and treatment. We have recently demonstrated that SFN inhibited the activation of PI3K/AKT and MAPK/ERK pathways which resulted in activation of FOXO transcription factors, leading to cell cycle arrest and apoptosis in pancreatic cancer cells (32), and inhibition of angiogenesis by HUVECs (43). However, the molecular targets of FOXOs and their mechanisms of action in cancer stem cells have never been examined.
The objectives of our study were to examine the molecular mechanisms by which SFN inhibits growth and induces apoptosis in pancreatic cancer stem cells. In addition, the interactive effects of quercetin and SFN on self-renewal capacity of pancreatic CSCs were also examined. Our data indicate that: (i) SFN inhibits self-renewal capacity of pancreatic CSCs, and quercetin further enhances the biological effects of SFN; (ii) SFN induces apoptosis by inhibiting the expression of Bcl-2 and XIAP, and phosphorylation of FKHR, and (iii) SFN inhibits the expression of EMT markers (vimentin, β-catenin, twist-1 and Zeb-1) suggesting its effects of early metastasis. These data suggest that SFN alone or in combination with quercetin can be a beneficial agent for the treatment and/or prevention of pancreatic cancer.
3. MATERIAL AND METHODS
3.1. Reagents
Antibodies against β-catenine, vimentin, phospho-FKHR, twist-1, ZEB-1, GAPDH, XIAP, caspase-3, Bcl-2, and Nanog were purchased from Cell Signaling Technology, Inc. (Danvers, MA). Sulforaphane and quercetin were purchased from LKT Laboratories, Inc. (St. Paul, MN). Enhanced chemiluminescence (ECL) Western blot detection reagents were from Amersham Life Sciences Inc. (Arlington Heights, IL). Terminal Deoxynucleotidyl Transferase Biotin-dUTP Nick End Labeling (TUNEL) assay kit was purchased from EMD Biosciences / Calbiochem (San Diego, CA). All other chemicals were purchased from Sigma-Aldrich (St Luis, MO).
32. Cell culture
PANC-1, MIA PaCa-2, AsPC-1 and Bx PC-3 cells were obtained from the American Type Culture Collection (Manassas, VA). Human pancreatic cancer stem cells (CD44+/CD24+/ESA+) were from Celprogen Inc. (San Pedro, CA). CSCs were cultured in DMEM supplemented with 1% N2 Supplement (Invitrogen), 2% B27 Supplement (Invitrogen), 20 ng/ml human platelet growth factor (Sigma-Aldrich), 100 ng/ml epidermal growth factor (Invitrogen) and 1% antibiotic-antimycotic (Invitrogen) at 37�C in a humidified atmosphere of 95% air and 5% CO2.
3.3. Tumor spheroid assay
Spheroid forming assays were performed as described elsewhere (9, 10). In brief, single cells were plated in six-well ultralow attachment plates (Corning Inc., Corning, NY) at a density of 1,000 cells/ml in DMEM supplemented with 1% N2 Supplement (Invitrogen), 2% B27 Supplement (Invitrogen), 20 ng/ml human platelet growth factor- (Sigma-Aldrich), 100 ng/ml epidermal growth factor (Invitrogen) and 1% antibiotic-antimycotic (Invitrogen) at 37�C in a humidified atmosphere of 95% air and 5% CO2. Spheroid were collected after 7 days and dissociated with Accutase (Innovative Cell Technologies, Inc.). The cells obtained from dissociation were sieved through a 40-�m filter, and counted by coulter counter using trypan blue dye.
3.4. Soft agar colony assay for assessment of tumorigenic potential in vitro
To examine the anchorage independent growth, the CSCs from both pancreatic cancer cell lines and primary tumors were suspended (103 cells/ml) in 2 ml of 0.3% agar with 1% N2 Supplement (Invitrogen), 2% B27 Supplement (Invitrogen), 20 ng/ml human platelet growth factor- (Sigma-Aldrich), 100 ng/ml epidermal growth factor (Invitrogen) and 1% antibiotic-antimycotic (Invitrogen) overlaid into six-well plates containing a 0.5% agar base. All samples were plated in triplicate. Colonies with >0.2 mm in diameter were counted on day 21. Colonies were stained with 0.001% crystal violet blue and counted.
3.5. Lentiviral vector-mediated transduction of pancreatic cancer stem cells
Lentiviral human Nanog construct (LL-hNANOGi) is described elsewhere (81). Target sequence for the Nanog was GGGTTAAGCTGTAACATACTT (NM_024865: bp 1857-1877). The shRNA was cloned under the control of the U6 promoter in the vector Lentilox 37. Lentiviral vectors, pseudotyped with the vesicular stomatitis virus (VSV) G protein, were produced in 293T cells as described (82-84). Viral supernatants were concentrated by ultracentrifugation to produce virus stocks with titers of 1 � 108 to 1 � 109 infectious units per milliliter. Titers were determined on 293 T cells. Human pancreatic cancer cells were transduced with viral particles with two rounds of infections.
3.6. Western blot analysis
Western blots were performed as we described earlier (38, 85). In brief, cells were lysed in RIPA buffer containing 1 X protease inhibitor cocktail, and protein concentrations were determined using the Bradford assay (Bio-Rad, Philadelphia, PA). Proteins were separated by 12.5% SDS/PAGE and transferred to membranes (Millipore, Bedford, MA) at 55 V for 4 h at 4�C. After blocking in 5% nonfat dry milk in TBS, the membranes were incubated with primary antibodies at 1:1,000 dilution in TBS overnight at 4�C, washed three times with TBS-Tween 20, and then incubated with secondary antibodies conjugated with horseradish peroxidase at 1:5,000 dilution in TBS for 1 hour at room temperature. Membranes were washed again in TBS-Tween 20 for three times at room temperature. Protein bands were visualized on X-ray film using an enhanced chemiluminescence detection system.
3.7. Statistical analysis
The mean and SD were calculated for each experimental group. Differences between groups were analyzed by one or two way ANOVA, followed by Bonferoni's multiple comparison tests using PRISM statistical analysis software (GrafPad Software, Inc., San Diego, CA). Significant differences among groups were calculated at P < 0.05.
4. RESULTS
4.1. Sulforaphane inhibits the growth of pancreatic cancer stem cells isolated from human pancreatic cancer cell lines
Since CSCs has been successfully isolated from established human cancer cells lines, we examined the effects of SFN on cancer stem cells (CD44+CD24+ESA+) isolated from human pancreatic cancer cell lines (Figure 1). Isolated CSCs were grown in pancreatic cancer stem cell medium in suspension (as described in Materials and Methods) and treated with various doses SFN (0-10 μM) for 7 days. At the end of incubation period, spheroids were harvested, resuspended, and cell viability was measured. SFN inhibited cell viability of pancreatic CSCs isolated from MIA-PACA-2, PANC-1, AsPC-1 and Bx-PC-3 cell lines in a dose-dependent manner. These data suggest that human pancreatic cancer cell lines possess a small population of CSCs which are responsive to SFN treatment.
4.2. Sulforaphane inhibits the formation of primary and secondary tumor spheroids and cell viability of pancreatic cancer stem cells
Since SFN inhibited the growth of CSCs isolated from established pancreatic cancer cell lines, we sought to examine whether SFN could also inhibit the growth of CSCs isolated from human primary pancreatic tumors. We first examined the effects of SFN on the CSC growth by measuring spheroids formation and cell viability. CSCs were grown in pancreatic cancer stem cell defined medium in suspension, and treated with SFN for 7 days. At the end of incubation period, spheroids in each well were photographed. SFN inhibited the growth of spheroids in suspension in a dose dependent manner (Figure 2A). The spheroids from each treatment group were collected and resuspended for counting cell viability. SFN inhibited stem cell viability of CSCs in a dose-dependent manner (Figure 2B). These data suggest that SFN can be effective in inhibiting the growth of pancreatic cancer stem cells.
4.3. Sulforaphane inhibits the growth of colonies formed by pancreatic cancer stem cells
Since SFN inhibited the growth of tumor spheroid and cell viability of CSCs, we sought to examine the effects of SFN on colony formation. Pancreatic CSCs were grown in agar, and treated with various doses of SFN for 3 weeks. At the end of incubation period, number of colonies were counted. SFN inhibited the growth of colonies in a dose-dependent manner (Figure 3). These data suggest that SFN can be an useful agent in targeting pancreatic cancer stem cells.
4.4. Inhibition of Nanog enhances the effects of sulforaphane on spheroid formation by human pancreatic cancer stem cells
Since pluripotent transcription factor Nanog is highly expressed in cancer stem cells compared to normal cells, we examined the effects of inhibiting Nanog on antiproliferative effects of SFN in human pancreatic CSCs expressing CD44+/CD24+/ESA+. Lentiviral mediated transduction of Nanog ShRNA inhibited Nanog protein expression (Figure 4). SFN inhibited stem cell viability in CSC spheroids transduced with Nanog-scrambled shRNA in a dose-dependent manner. The inhibition of Nanog by shRNA further enhanced the antiproliferative effects of SFN on CSCc. These data suggest that inhibition of Nanog may be an attractive target to enhance the anticancer activities of SFN in CSCs.
4.5. Sulforaphane inhibits the expression of XIAP and Bcl-2 and phosphorylation of FKHR, and cleaves caspase-3 in human pancreatic cancer stem cells
We next examined the effects of SFN on the expression of XIAP and Bcl-2, phosphorylation of FKHR, cleavage of caspase-3, and apoptosis (Figure 5). SFN inhibited the expression of XIAP, Bcl-2 and cleaved pro-caspase-3 in pancreatic CSCs (Figure 5A). SFN also inhibited the phosphorylation of FKHR suggesting the inhibition of PI3K/AKT pathway leading to activation of FOXO transcription factor. SFN induced apoptosis in pancreatic CSCs in a dose-dependent manner as measured by TUNEL assay (Figure 5B). These data suggest that SFN can induce apoptosis in CSCs by engaging mitochondria because Bcl-2 mainly exerts its effects at the level of mitochondria. The inhibition of XIAP by SFN will further releave caspases to induce apoptosis in CSCs.
4.6. Sulforaphane inhibits the expression of epithelial-mesenchymal transition markers (EMT) in human pancreatic cancer stem cells
Cancer stem cells have been shown to express EMT markers. FOXO proteins are mainly regulated through phosphorylation by upstream kinase AKT and ERK (32, 43). We therefore examined the regulation of EMT markers by SFN. As expected, SFN inhibited the expression of β-catenin, vimentin, Twist-1 and Zeb-1 (Figure 6). These data suggest that inhibition of EMT markers my SFN could inhibit early metastasis of cancer stem cells.
4.7. Quercetin enhances the effects of sulforaphane on spheroid and colony formation by pancreatic cancer stem cells
Quercetin has been shown to enhance the effects of anticancer drugs and sensitize cancer cells to chemotherapy and radiotherapy. We therefore examined whether quercetin enhances the effects of SFN on spheroid and colony formation by pancreatic CSCs (Figure 7). SFN inhibited the cell viability and colony formation of pancreatic CSCs in a dose-dependent manner. Quercetin, although effective alone, further enhanced the biological effects of SFN on cell viability (in spheroids) and colony formation. These data suggest that quercetin can be used with SFN to selectively target pancreatic CSCs.
5. DISCUSSION
Our study demonstrates, for the first time, that cancer preventive effects of SFN are regulated through activation of FOXO transcription factor FKHR and inhibition of stem-cell pluripotent transcription factor Nanog. Specifically, we have demonstrated that (i) SFN inhibits the expression of EMT markers (vimentin, β-catenin, twist-1, and Zeb-1), (ii) SFN induces the activation of FOXO transcription factor by inhibiting the phosphorylation of FKHR, (iii) SFN induces apoptosis by inhibiting Bcl-2 and XIAP expression, and activating caspase-3; and (iv) SFN inhibits self-renewal capacity of pancreatic CSC and synergizes with quercetin. Furthermore, we have convincingly demonstrated that inhibition of Nanog may be an attractive target to enhance the anticancer activities of SFN. Our data are in agreement with others who demonstrated the anticancer activity of SFN in pancreatic cancer stem cells (33, 34, 36, 86).
SFN inhibits the factors required for maintaining the pluripotency in CSCs. Nanog, Oct-4 and Sox-2 co-occupy and regulate their own promoters together with other developmental genes with diverse functions and collaborate to form an extensive regulatory circuitry including autoregulatory and feed-forward loops (87-89). A high level of Nanog is a key regulator of embryonic stem cell (ESC) self-renewal and pluripotency. Nanog-deficient ES cells and embryos lose their pluripotency (90). Nanog overexpression leads to the clonal expansion of ES cells through circumvention of the LIF-dependent Stat-3 pathway and sustained Oct-4 expression levels (90, 91). Genome-wide gene expression profiling shows that Nanog is expressed at high levels in testicular carcinoma in situ and germ cell tumors (92). In the present study, the inhibition of Nanog attenuated the self-renewal capacity of pancreatic cancer stem cells, and enhanced the antiproliferative effects of SFN. These data suggest that inhibition of Nanog expression could be a novel strategy to kill CSCs.
Epithelial-to-mesenchymal transition (EMT) is an embryonic program in which epithelial cells lose their characteristics and gain mesenchymal features. Therefore, EMT might play a very important role during malignant tumor progression. Accumulating evidence suggest that transformed epithelial cells can activate embryonic programs of epithelial plasticity and switch from a sessile, epithelial phenotype to a motile, mesenchymal phenotype. Induction of EMT can, therefore, lead to invasion of surrounding stroma, intravasation, dissemination and colonization of distant sites. Under the cancer stem cell hypothesis, sustained metastatic growth requires the dissemination of a CSC from the primary tumor followed by its re-establishment in a secondary site. The EMT, a differentiation process crucial to normal development, has been implicated in conferring metastatic ability on carcinomas. In the present study, sulforaphane inhibited the expression of EMT markers and also inhibited the transcription factors which are required for induction of EMT.
The combinations of chemopreventive agents have been shown to exert synergistic effects on cancer cell growth. In our study, quercetin acted with SFN in a synergistic manner to inhibit the self-renewal capacity of pancreatic cancer stem cells. In a recent report, quercetin inhibited growth of cancer stem cell-enriched xenografts associated with reduced proliferation, angiogenesis, cancer stem cell-marker expression and induction of apoptosis (93). Furthermore, co-incubation with SFN increased these effects and no pronounced toxicity on normal cells or mice was observed. Since carcinogenesis is a complex process, combination of bioactive dietary agents with complementary activities will be beneficial for pancreatic cancer treatment and prevention.
Flavonols are a class of flavonoids, polyphenols, which are ubiquitous in plant foods and are known compounds of beer. Flavonol intake reduces the risk for developing pancreatic cancer (94-96). The pharmacokinetics of quercetin has been been carried out both in animals and humans (97-99). Flavonoid glycosides are believed to pass through the small intestine, be hydrolyzed to aglycone by enterobacteria in the cecum and colon and absorbed into epithelial cells via lipophilicity-dependent simple diffusion (100). Quercetin glucosides can also be directly absorbed via the sodium-dependent glucose transporter-1 (SGLT-1) or excreted into the lumen via multidrug resistance protein 2 (MRP-2) (101). After their facilitated uptake by means of carrier-mediated transport, quercetin glycosides are often hydrolyzed by intracellular β-glucosidases (99). The intestinal lactase phlorizin hydrolase (LPH) displays a specific activity towards flavonoid glycosides (102). Hydrolysis to a glycone by enterocytes or enterobacteria is crucial for the efficient absorption of quercetin glucosides in the intestinal tract. Quercetin absorbed from the intestinal lumen is mostly converted to conjugated metabolites before entering circulation, and the major metabolites present in human plasma are quercetin 3′-O-β-d-glucuronide (Q3′GA) and quercetin 4′-O-β-d-glucuronide (Q4′GA). Interestingly, some metabolites still possess considerable activity, including Q3GA, Q3′GA and Q4′GA (103). Furthermore, quercetin is concentrated in lungs, testes, kidneys, thymus, heart and liver, with the highest concentrations of quercetin and its methylated derivatives detected in the pulmonary tissue (104). Urinary elimination of quercetin is not the main excretion routes in human subjects or in rats. A substantial portion of the metabolites may be excreted in the bile (101). The low bioavailability of quercetin and high metabolite concentrations indicate an extensive first-pass metabolism in the gut and/or the liver (105, 106). Additionally, the high concentration of conjugated quercetin observed in the bile indicates potential enterohepatic recirculation (107). Following ingestion of quercetin (100 mg), a half-life range of 31-50 h was observed in humans, with peak plasma levels observed at 30 min and again at 8 h post-treatment (108). The half lives of the quercetin metabolites are 11 to 28 h, indicating that the metabolites could attain a considerable plasma level upon repeated quercetin supplementation (98, 109).
FOXO transcription factors play a crucial role in the regulation of tissue homeostasis in organs such as the pancreas and the ovaries and complex diseases such as diabetes and cancer (110-113). FOXO transcription factors are emerging as critical transcriptional integrators among pathways regulating differentiation, proliferation, survival, and angiogenesis (114-117). Gene expression profiling showed that FOXO1 and FOXO3a specifically regulate a nonredundant but overlapping set of angiogenesis- and vascular remodeling-related genes (117). We have recently demonstrated that inhibition of the MEK/ERK and PI3K/AKT pathways synergistically induced FOXO transcriptional activity and inhibited cancer cell growth and angiogenesis; these events were further enhanced in the presence of sulforaphane, resveratrol and EGCG (43, 118, 119). Phosphorylation deficient mutants of FOXO enhanced anti-angiogenic effects of sulforaphane, resveratrol and EGCG by activating the FOXO transcription factors. These studies suggest that activation of FOXO transcription factors by these dietary agents could be an important physiological process to inhibit tumor growth and angiogenesis. The ability of sulforaphane to inhibit the phosphorylation of FKHR suggests the activation of PI3K/AKT pathway in pancreatic cancer stem cells. Thus, FKHR may be a crucial molecular target for regulation of self-renewal capacity of cancer stem cells.
In conclusion, we have demonstrated that surforaphane inhibited self-renewal capacity of pancreatic cancer stem cells, and these properties of SFN were enhanced with quercetin. SFN inhibited the expression of transcription factors which are required for maintaining stem-cell pluripotency. Inhibition of Nanog could be considered as a novel strategy to enhance the biological effects of anticancer and chemopreventive agents or sensitize those cells which are resistant to chemotherapy or irradiation. Moreover, sulforaphane inhibited expression of proteins involved in the epithelial-mesenchymal transition, suggesting the blockade of signaling involved in early metastasis. Furthermore, combination of quercetin with sulforaphane had synergistic effects on self-renewal capacity of pancreatic cancer stem cells. These data suggest that sulforaphane either alone or in combination with quercetin can be used for the prevention and/or treatment of pancreatic cancer. However, further studies are needed to validate the combination of SFN and quercetin in an appropriate in vivo model.
6. ACKNOWLEDGEMENTS
We thank our lab members for critical reading of the manuscript. This work was supported in part by the grants from the National Institutes of Health (R01CA125262, R01CA125262-02S1 and RO1CA114469), and Kansas Bioscience Authority.
7. REFERENCES
1. L. Warshaw and C. Fernandez-del Castillo: Pancreatic carcinoma. N Engl J Med, 326(7), 455-65 (1992)
doi:10.1056/NEJM199202133260706
PMid:1732772
2. C. J. Magee, P. Ghaneh and J. P. Neoptolemos: Surgical and medical therapy for pancreatic carcinoma. Best Pract Res Clin Gastroenterol, 16(3), 435-55 (2002)
doi:10.1053/bega.2002.0317
3. T. P. Yeo, R. H. Hruban, S. D. Leach, R. E. Wilentz, T. A. Sohn, S. E. Kern, C. A. Iacobuzio-Donahue, A. Maitra, M. Goggins, M. I. Canto, R. A. Abrams, D. Laheru, E. M. Jaffee, M. Hidalgo and C. J. Yeo: Pancreatic cancer. Curr Probl Cancer, 26(4), 176-275 (2002)
doi:10.1067/mcn.2002.129579
PMid:12399802
4. R. J. Jones, W. H. Matsui and B. D. Smith: Cancer stem cells: are we missing the target? J Natl Cancer Inst, 96(8), 583-5 (2004)
doi:10.1093/jnci/djh095
5. T. Reya, S. J. Morrison, M. F. Clarke and I. L. Weissman: Stem cells, cancer, and cancer stem cells. Nature, 414(6859), 105-11 (2001) doi:10.1038/35102167 35102167 (pii)
6. F. Bednar and D. M. Simeone: Pancreatic cancer stem cells and relevance to cancer treatments. J Cell Biochem, 107(1), 40-5 (2009)
doi:10.1002/jcb.22093
PMid:19301275
7. I. Ischenko, H. Seeliger, A. Kleespies, M. K. Angele, M. E. Eichhorn, K. W. Jauch and C. J. Bruns: Pancreatic cancer stem cells: new understanding of tumorigenesis, clinical implications. Langenbecks Arch Surg, 395(1), 1-10 (2010)
doi:10.1007/s00423-009-0502-z
PMid:19421768
8. C. J. Lee, J. Dosch and D. M. Simeone: Pancreatic cancer stem cells. J Clin Oncol, 26(17), 2806-12 (2008)
doi:26/17/2806 (pii) 10.1200/JCO.2008.16.6702
9. C. Li, D. G. Heidt, P. Dalerba, C. F. Burant, L. Zhang, V. Adsay, M. Wicha, M. F. Clarke and D. M. Simeone: Identification of pancreatic cancer stem cells. Cancer Res, 67(3), 1030-7 (2007)
doi:67/3/1030 (pii) 10.1158/0008-5472.CAN-06-2030
10. C. Li, C. J. Lee and D. M. Simeone: Identification of human pancreatic cancer stem cells. Methods Mol Biol, 568, 161-73 (2009)
doi:10.1007/978-1-59745-280-9_10
PMid:19582426
11. M. T. Mueller, P. C. Hermann and C. Heeschen: Cancer stem cells as new therapeutic target to prevent tumour progression and metastasis. Front Biosci (Elite Ed), 2, 602-13 (2010) doi:117 (pii)
12. D. M. Simeone: Pancreatic cancer stem cells: implications for the treatment of pancreatic cancer. Clin Cancer Res, 14(18), 5646-8 (2008) doi:14/18/5646 (pii) 10.1158/1078-0432.CCR-08-0584
13. H. Korkaya, A. Paulson, E. Charafe-Jauffret, C. Ginestier, M. Brown, J. Dutcher, S. G. Clouthier and M. S. Wicha: Regulation of mammary stem/progenitor cells by PTEN/Akt/beta-catenin signaling. PLoS Biol, 7(6), e1000121 (2009)
doi:10.1371/journal.pbio.1000121
PMid:19492080 PMCid:2683567
14. D. Hambardzumyan, M. Squatrito and E. C. Holland: Radiation resistance and stem-like cells in brain tumors. Cancer Cell, 10(6), 454-6 (2006)
doi:S1535-6108(06)00346-1 (pii) 10.1016/j.ccr.2006.11.008
15. N. Shafee, C. R. Smith, S. Wei, Y. Kim, G. B. Mills, G. N. Hortobagyi, E. J. Stanbridge and E. Y. Lee: Cancer stem cells contribute to cisplatin resistance in Brca1/p53-mediated mouse mammary tumors. Cancer Res, 68(9), 3243-50 (2008)
doi:68/9/3243 (pii) 10.1158/0008-5472.CAN-07-5480
16. R. J. Jones: Cancer stem cells-clinical relevance. J Mol Med, 87(11), 1105-10 (2009)
doi:10.1007/s00109-009-0534-4
PMid:19816664
17. S. K. Singh, I. D. Clarke, M. Terasaki, V. E. Bonn, C. Hawkins, J. Squire and P. B. Dirks: Identification of a cancer stem cell in human brain tumors. Cancer Res, 63(18), 5821-8 (2003)
PMid:14522905
18. S. K. Singh, C. Hawkins, I. D. Clarke, J. A. Squire, J. Bayani, T. Hide, R. M. Henkelman, M. D. Cusimano and P. B. Dirks: Identification of human brain tumour initiating cells. Nature, 432(7015), 396-401 (2004) doi:nature03128 (pii) 10.1038/nature03128
19. H. D. Hemmati, I. Nakano, J. A. Lazareff, M. Masterman-Smith, D. H. Geschwind, M. Bronner-Fraser and H. I. Kornblum: Cancerous stem cells can arise from pediatric brain tumors. Proc Natl Acad Sci U S A, 100(25), 15178-83 (2003)
doi:10.1073/pnas.2036535100 2036535100 (pii)
20. C. A. O'Brien, A. Pollett, S. Gallinger and J. E. Dick: A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature, 445(7123), 106-10 (2007) doi:nature05372 (pii) 10.1038/nature05372
21. L. Ricci-Vitiani, D. G. Lombardi, E. Pilozzi, M. Biffoni, M. Todaro, C. Peschle and R. De Maria: Identification and expansion of human colon-cancer-initiating cells. Nature, 445(7123), 111-5 (2007) doi:nature05384 (pii) 10.1038/nature05384
22. L. Ricci-Vitiani, A. Pagliuca, E. Palio, A. Zeuner and R. De Maria: Colon cancer stem cells. Gut, 57(4), 538-48 (2008)
doi:57/4/538 (pii) 10.1136/gut.2007.127837
23. S. Yin, J. Li, C. Hu, X. Chen, M. Yao, M. Yan, G. Jiang, C. Ge, H. Xie, D. Wan, S. Yang, S. Zheng and J. Gu: CD133 positive hepatocellular carcinoma cells possess high capacity for tumorigenicity. Int J Cancer, 120(7), 1444-50 (2007)
doi:10.1002/ijc.22476
PMid:17205516
24. S. Ma, K. W. Chan, L. Hu, T. K. Lee, J. Y. Wo, I. O. Ng, B. J. Zheng and X. Y. Guan: Identification and characterization of tumorigenic liver cancer stem/progenitor cells. Gastroenterology, 132(7), 2542-56 (2007)
doi:S0016-5085(07)00786-X (pii) 10.1053/j.gastro.2007.04.025
25. R. Birnie, S. D. Bryce, C. Roome, V. Dussupt, A. Droop, S. H. Lang, P. A. Berry, C. F. Hyde, J. L. Lewis, M. J. Stower, N. J. Maitland and A. T. Collins: Gene expression profiling of human prostate cancer stem cells reveals a pro-inflammatory phenotype and the importance of extracellular matrix interactions. Genome Biol, 9(5), R83 (2008)
doi:gb-2008-9-5-r83 (pii) 10.1186/gb-2008-9-5-r83
26. C. L. Eaton, M. Colombel, G. van der Pluijm, M. Cecchini, A. Wetterwald, J. Lippitt, I. Rehman, F. Hamdy and G. Thalman: Evaluation of the frequency of putative prostate cancer stem cells in primary and metastatic prostate cancer. Prostate, 70(8), 875-82 (2010)
doi:10.1002/pros.21121
PMid:20127735
27. N. J. Maitland, S. D. Bryce, M. J. Stower and A. T. Collins: Prostate cancer stem cells: a target for new therapies. Ernst Schering Found Symp Proc(5), 155-79 (2006)
28. M. Trerotola, S. Rathore, H. L. Goel, J. Li, S. Alberti, M. Piantelli, D. Adams, Z. Jiang and L. R. Languino: CD133, Trop-2 and alpha2beta1 integrin surface receptors as markers of putative human prostate cancer stem cells. Am J Transl Res, 2(2), 135-44 (2010)
PMid:20407603 PMCid:2855629
29. P. C. Hermann, S. L. Huber, T. Herrler, A. Aicher, J. W. Ellwart, M. Guba, C. J. Bruns and C. Heeschen: Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell Stem Cell, 1(3), 313-23 (2007)
doi:S1934-5909(07)00066-5 (pii) 10.1016/j.stem.2007.06.002
30. K. Quint, S. Stintzing, B. Alinger, C. Hauser-Kronberger, O. Dietze, S. Gahr, E. G. Hahn, M. Ocker and D. Neureiter: The expression pattern of PDX-1, SHH, Patched and Gli-1 is associated with pathological and clinical features in human pancreatic cancer. Pancreatology, 9(1-2), 116-26 (2009)
doi:000178882 (pii) 10.1159/000178882
31. Y. Katoh and M. Katoh: Hedgehog signaling pathway and gastrointestinal stem cell signaling network (review). Int J Mol Med, 18(6), 1019-23 (2006)
PMid:17089004
32. S. K. Roy, R. K. Srivastava and S. Shankar: Inhibition of PI3K/AKT and MAPK/ERK pathways causes activation of FOXO transcription factor, leading to cell cycle arrest and apoptosis in pancreatic cancer. J Mol Signal, 5(1), 10 (2010)
doi:1750-2187-5-10 (pii) 10.1186/1750-2187-5-10
33. B. Hutzen, W. Willis, S. Jones, L. Cen, S. Deangelis, B. Fuh and J. Lin: Dietary agent, benzyl isothiocyanate inhibits signal transducer and activator of transcription 3 phosphorylation and collaborates with sulforaphane in the growth suppression of PANC-1 cancer cells. Cancer Cell Int, 9, 24 (2009)
doi:1475-2867-9-24 (pii) 10.1186/1475-2867-9-24
34. G. Kallifatidis, V. Rausch, B. Baumann, A. Apel, B. M. Beckermann, A. Groth, J. Mattern, Z. Li, A. Kolb, G. Moldenhauer, P. Altevogt, T. Wirth, J. Werner, P. Schemmer, M. W. Buchler, A. V. Salnikov and I. Herr: Sulforaphane targets pancreatic tumour-initiating cells by NF-kappaB-induced antiapoptotic signalling. Gut, 58(7), 949-63 (2009)
doi:gut.2008.149039 (pii) 10.1136/gut.2008.149039
35. J. W. Lampe: Sulforaphane: from chemoprevention to pancreatic cancer treatment? Gut, 58(7), 900-2 (2009)
doi:58/7/900 (pii) 10.1136/gut.2008.166694
36. N. A. Pham, J. W. Jacobberger, A. D. Schimmer, P. Cao, M. Gronda and D. W. Hedley: The dietary isothiocyanate sulforaphane targets pathways of apoptosis, cell cycle arrest, and oxidative stress in human pancreatic cancer cells and inhibits tumor growth in severe combined immunodeficient mice. Mol Cancer Ther, 3(10), 1239-48 (2004)
doi:3/10/1239 (pii)
37. Y. Li, T. Zhang, H. Korkaya, S. Liu, H. F. Lee, B. Newman, Y. Yu, S. G. Clouthier, S. J. Schwartz, M. S. Wicha and D. Sun: Sulforaphane, a Dietary Component of Broccoli/Broccoli Sprouts, Inhibits Breast Cancer Stem Cells. Clin Cancer Res (2010)
doi:1078-0432.CCR-09-2937 (pii) 10.1158/1078-0432.CCR-09-2937
38. S. Shankar, S. Ganapathy and R. K. Srivastava: Sulforaphane enhances the therapeutic potential of TRAIL in prostate cancer orthotopic model through regulation of apoptosis, metastasis, and angiogenesis. Clin Cancer Res, 14(21), 6855-66 (2008) doi:14/21/6855 (pii) 10.1158/1078-0432.CCR-08-0903
39. S. Batra, R. P. Sahu, P. K. Kandala and S. K. Srivastava: Benzyl isothiocyanate-mediated inhibition of histone deacetylase leads to NF-kappaB turnoff in human pancreatic carcinoma cells. Mol Cancer Ther, 9(6), 1596-608 (2010)
doi:1535-7163.MCT-09-1146 (pii) 10.1158/1535-7163.MCT-09-1146
40. A. Basu and S. Haldar: Anti-proliferative and proapoptotic effects of benzyl isothiocyanate on human pancreatic cancer cells is linked to death receptor activation and RasGAP/Rac1 down-modulation. Int J Oncol, 35(3), 593-9 (2009)
PMid:19639179
41. S. K. Srivastava and S. V. Singh: Cell cycle arrest, apoptosis induction and inhibition of nuclear factor kappa B activation in anti-proliferative activity of benzyl isothiocyanate against human pancreatic cancer cells. Carcinogenesis, 25(9), 1701-9 (2004)
doi:10.1093/carcin/bgh179 bgh179 (pii)
42. S. Cauchi, W. Han, S. V. Kumar and S. D. Spivack: Haplotype-environment interactions that regulate the human glutathione S-transferase P1 promoter. Cancer Res, 66(12), 6439-48 (2006)
doi:10.1158/0008-5472.CAN-05-4457
PMid:16778223
43. R. Davis, K. P. Singh, R. Kurzrock and S. Shankar: Sulforaphane inhibits angiogenesis through activation of FOXO transcription factors. Oncol Rep, 22(6), 1473-8 (2009)
PMid:19885601
44. M. G. Hertog, E. J. Feskens, P. C. Hollman, M. B. Katan and D. Kromhout: Dietary antioxidant flavonoids and risk of coronary heart disease: the Zutphen Elderly Study. Lancet, 342(8878), 1007-11 (1993) doi:0140-6736(93)92876-U (pii)
45. M. G. Hertog, D. Kromhout, C. Aravanis, H. Blackburn, R. Buzina, F. Fidanza, S. Giampaoli, A. Jansen, A. Menotti, S. Nedeljkovic and et al.: Flavonoid intake and long-term risk of coronary heart disease and cancer in the seven countries study. Arch Intern Med, 155(4), 381-6 (1995)
doi:10.1001/archinte.155.4.381
PMid:7848021
46. P. Knekt, R. Jarvinen, R. Seppanen, M. Hellovaara, L. Teppo, E. Pukkala and A. Aromaa: Dietary flavonoids and the risk of lung cancer and other malignant neoplasms. Am J Epidemiol, 146(3), 223-30 (1997)
PMid:9247006
47. S. J. Lee, Y. S. Jung, S. H. Lee, H. Y. Chung and B. J. Park: Isolation of a chemical inhibitor against K-Ras-induced p53 suppression through natural compound screening. Int J Oncol, 34(6), 1637-43 (2009)
PMid:19424582
48. L. Zhang, E. Angst, J. L. Park, A. Moro, D. W. Dawson, H. A. Reber, G. Eibl, O. J. Hines, V. L. Go and Q. Y. Lu: Quercetin aglycone is bioavailable in murine pancreas and pancreatic xenografts. J Agric Food Chem, 58(12), 7252-7 (2010)
doi:10.1021/jf101192k
PMid:20499918
49. W. Zhou, G. Kallifatidis, B. Baumann, V. Rausch, J. Mattern, J. Gladkich, N. Giese, G. Moldenhauer, T. Wirth, M. W. Buchler, A. V. Salnikov and I. Herr: Dietary polyphenol quercetin targets pancreatic cancer stem cells. Int J Oncol, 37(3), 551-61 (2010)
PMid:20664924
50. J. Duraj, K. Zazrivcova, J. Bodo, M. Sulikova and J. Sedlak: Flavonoid quercetin, but not apigenin or luteolin, induced apoptosis in human myeloid leukemia cells and their resistant variants. Neoplasma, 52(4), 273-9 (2005)
PMid:16059641
51. S. Kothan, S. Dechsupa, G. Leger, J. L. Moretti, J. Vergote and S. Mankhetkorn: Spontaneous mitochondrial membrane potential change during apoptotic induction by quercetin in K562 and K562/adr cells. Can J Physiol Pharmacol, 82(12), 1084-90 (2004)
doi:y04-113 (pii) 10.1139/y04-113
52. T. Efferth, M. Davey, A. Olbrich, G. Rucker, E. Gebhart and R. Davey: Activity of drugs from traditional Chinese medicine toward sensitive and MDR1- or MRP1-overexpressing multidrug-resistant human CCRF-CEM leukemia cells. Blood Cells Mol Dis, 28(2), 160-8 (2002)
doi:S1079979602904924 (pii)
53. P. Limtrakul, O. Khantamat and K. Pintha: Inhibition of P-glycoprotein function and expression by kaempferol and quercetin. J Chemother, 17(1), 86-95 (2005)
PMid:15828450
54. C. L. Shapiro, L. Ayash, I. J. Webb, R. Gelman, J. Keating, L. Williams, G. Demetri, P. Clark, A. Elias, D. Duggan, D. Hayes, D. Hurd and I. C. Henderson: Repetitive cycles of cyclophosphamide, thiotepa, and carboplatin intensification with peripheral-blood progenitor cells and filgrastim in advanced breast cancer patients. J Clin Oncol, 15(2), 674-83 (1997)
PMid:9053493
55. E. M. Leslie, Q. Mao, C. J. Oleschuk, R. G. Deeley and S. P. Cole: Modulation of multidrug resistance protein 1 (MRP1/ABCC1) transport and atpase activities by interaction with dietary flavonoids. Mol Pharmacol, 59(5), 1171-80 (2001)
PMid:11306701
56. S. Y. Chung, M. K. Sung, N. H. Kim, J. O. Jang, E. J. Go and H. J. Lee: Inhibition of P-glycoprotein by natural products in human breast cancer cells. Arch Pharm Res, 28(7), 823-8 (2005)
doi:10.1007/BF02977349
PMid:16114498
57. J. J. van Zanden, H. van der Woude, J. Vaessen, M. Usta, H. M. Wortelboer, N. H. Cnubben and I. M. Rietjens: The effect of quercetin phase II metabolism on its MRP1 and MRP2 inhibiting potential. Biochem Pharmacol, 74(2), 345-51 (2007)
doi:S0006-2952(07)00221-3 (pii) 10.1016/j.bcp.2007.04.002
58. N. Galili, R. J. Davis, W. J. Fredericks, S. Mukhopadhyay, F. J. Rauscher, 3rd, B. S. Emanuel, G. Rovera and F. G. Barr: Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet, 5(3), 230-5 (1993)
doi:10.1038/ng1193-230
PMid:8275086
59. E. Anderson, R. B. Clarke and A. Howell: Estrogen responsiveness and control of normal human breast proliferation. J Mammary Gland Biol Neoplasia, 3(1), 23-35 (1998)
doi:10.1023/A:1018718117113
PMid:10819502
60. J. Hillion, M. Le Coniat, P. Jonveaux, R. Berger and O. A. Bernard: AF6q21, a novel partner of the MLL gene in t(6;11)(q21;q23), defines a forkhead transcriptional factor subfamily. Blood, 90(9), 3714-9 (1997)
PMid:9345057
61. A. Borkhardt, R. Repp, O. A. Haas, T. Leis, J. Harbott, J. Kreuder, J. Hammermann, T. Henn and F. Lampert: Cloning and characterization of AFX, the gene that fuses to MLL in acute leukemias with a t(X;11)(q13;q23). Oncogene, 14(2), 195-202 (1997)
doi:10.1038/sj.onc.1200814
PMid:9010221
62. L. P. Van Der Heide, M. F. Hoekman and M. P. Smidt: The ins and outs of FoxO shuttling: mechanisms of FoxO translocation and transcriptional regulation. Biochem J, 380(Pt 2), 297-309 (2004)
doi:10.1042/BJ20040167
PMid:15005655 PMCid:1224192
63. A. Brunet, A. Bonni, M. J. Zigmond, M. Z. Lin, P. Juo, L. S. Hu, M. J. Anderson, K. C. Arden, J. Blenis and M. E. Greenberg: Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell, 96(6), 857-68 (1999)
PMid:10358076
64. S. Guo, G. Rena, S. Cichy, X. He, P. Cohen and T. Unterman: Phosphorylation of serine 256 by protein kinase B disrupts transactivation by FKHR and mediates effects of insulin on insulin-like growth factor-binding protein-1 promoter activity through a conserved insulin response sequence. J Biol Chem, 274(24), 17184-92 (1999)
doi:10.1074/jbc.274.24.17184
PMid:10783894
65. R. H. Medema, G. J. Kops, J. L. Bos and B. M. Burgering: AFX-like Forkhead transcription factors mediate cell-cycle regulation by Ras and PKB through p27kip1. Nature, 404(6779), 782-7 (2000)
doi:10.1038/35008115
PMid:11073996 PMCid:86551
66. N. Nakamura, S. Ramaswamy, F. Vazquez, S. Signoretti, M. Loda and W. R. Sellers: Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Mol Cell Biol, 20(23), 8969-82 (2000)
doi:10.1128/MCB.20.23.8969-8982.2000
PMid:11094066 PMCid:102172
67. P. F. Dijkers, R. H. Medema, C. Pals, L. Banerji, N. S. Thomas, E. W. Lam, B. M. Burgering, J. A. Raaijmakers, J. W. Lammers, L. Koenderman and P. J. Coffer: Forkhead transcription factor FKHR-L1 modulates cytokine-dependent transcriptional regulation of p27(KIP1). Mol Cell Biol, 20(24), 9138-48 (2000)
doi:10.1128/MCB.20.24.9138-9148.2000
PMid:11815629 PMCid:2173339
68. P. F. Dijkers, K. U. Birkenkamp, E. W. Lam, N. S. Thomas, J. W. Lammers, L. Koenderman and P. J. Coffer: FKHR-L1 can act as a critical effector of cell death induced by cytokine withdrawal: protein kinase B-enhanced cell survival through maintenance of mitochondrial integrity. J Cell Biol, 156(3), 531-42 (2002)
doi:10.1083/jcb.200108084
PMid:12931221
69. A. Cappellini, G. Tabellini, M. Zweyer, R. Bortul, P. L. Tazzari, A. M. Billi, F. Fala, L. Cocco and A. M. Martelli: The phosphoinositide 3-kinase/Akt pathway regulates cell cycle progression of HL60 human leukemia cells through cytoplasmic relocalization of the cyclin-dependent kinase inhibitor p27(Kip1) and control of cyclin D1 expression. Leukemia, 17(11), 2157-67 (2003)
doi:10.1038/sj.leu.2403111
70. B. M. Burgering and G. J. Kops: Cell cycle and death control: long live Forkheads. Trends Biochem Sci, 27(7), 352-60 (2002)
doi:10.1016/S0968-0004(02)02113-8
71. P. F. Dijkers, R. H. Medema, J. W. Lammers, L. Koenderman and P. J. Coffer: Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Curr Biol, 10(19), 1201-4 (2000)
doi:10.1016/S0960-9822(00)00728-4
PMid:12913110 PMCid:2173804
72. J. Gilley, P. J. Coffer and J. Ham: FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons. J Cell Biol, 162(4), 613-22 (2003)
doi:10.1083/jcb.200303026
PMid:11777915
73. T. T. Tang, D. Dowbenko, A. Jackson, L. Toney, D. A. Lewin, A. L. Dent and L. A. Lasky: The forkhead transcription factor AFX activates apoptosis by induction of the BCL-6 transcriptional repressor. J Biol Chem, 277(16), 14255-65 (2002)
doi:10.1074/jbc.M110901200
PMid:10781373
74. R. A. Perugini, T. P. McDade, F. J. Vittimberga, Jr. and M. P. Callery: Pancreatic cancer cell proliferation is phosphatidylinositol 3-kinase dependent. J Surg Res, 90(1), 39-44 (2000)
doi:10.1006/jsre.2000.5833
75. S. A. Shah, M. W. Potter, M. H. Hedeshian, R. D. Kim, R. S. Chari and M. P. Callery: PI-3' kinase and NF-kappaB cross-signaling in human pancreatic cancer cells. J Gastrointest Surg, 5(6), 603-12; discussion 612-3 (2001)
doi:10.1016/S1091-255X(01)80102-5
PMid:10102273
76. V. M. Bondar, B. Sweeney-Gotsch, M. Andreeff, G. B. Mills and D. J. McConkey: Inhibition of the phosphatidylinositol 3'-kinase-AKT pathway induces apoptosis in pancreatic carcinoma cells in vitro and in vivo. Mol Cancer Ther, 1(12), 989-97 (2002)
PMid:12481421
77. J. Q. Cheng, B. Ruggeri, W. M. Klein, G. Sonoda, D. A. Altomare, D. K. Watson and J. R. Testa: Amplification of AKT2 in human pancreatic cells and inhibition of AKT2 expression and tumorigenicity by antisense RNA. Proc Natl Acad Sci U S A, 93(8), 3636-41 (1996)
doi:10.1073/pnas.93.8.3636
78. B. A. Ruggeri, L. Huang, M. Wood, J. Q. Cheng and J. R. Testa: Amplification and overexpression of the AKT2 oncogene in a subset of human pancreatic ductal adenocarcinomas. Mol Carcinog, 21(2), 81-6 (1998)
doi:10.1002/(SICI)1098-2744(199802)21:2<81::AID-MC1>3.0.CO;2-R
79. D. A. Altomare, S. Tanno, A. De Rienzo, A. J. Klein-Szanto, S. Tanno, K. L. Skele, J. P. Hoffman and J. R. Testa: Frequent activation of AKT2 kinase in human pancreatic carcinomas. J Cell Biochem, 88(1), 470-6 (2003)
80. M. G. Schlieman, B. N. Fahy, R. Ramsamooj, L. Beckett and R. J. Bold: Incidence, mechanism and prognostic value of activated AKT in pancreas cancer. Br J Cancer, 89(11), 2110-5 (2003)
doi:10.1038/sj.bjc.6601396
PMid:14647146 PMCid:2376856
81. H. Zaehres, M. W. Lensch, L. Daheron, S. A. Stewart, J. Itskovitz-Eldor and G. Q. Daley: High-efficiency RNA interference in human embryonic stem cells. Stem Cells, 23(3), 299-305 (2005)
doi:23/3/299 (pii) 10.1634/stemcells.2004-0252
82. S. A. Stewart, D. M. Dykxhoorn, D. Palliser, H. Mizuno, E. Y. Yu, D. S. An, D. M. Sabatini, I. S. Chen, W. C. Hahn, P. A. Sharp, R. A. Weinberg and C. D. Novina: Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA, 9(4), 493-501 (2003)
83. D. A. Rubinson, C. P. Dillon, A. V. Kwiatkowski, C. Sievers, L. Yang, J. Kopinja, D. L. Rooney, M. Zhang, M. M. Ihrig, M. T. McManus, F. B. Gertler, M. L. Scott and L. Van Parijs: A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet, 33(3), 401-6 (2003)
doi:10.1038/ng1117 ng1117 (pii)
84. J. C. Burns, T. Friedmann, W. Driever, M. Burrascano and J. K. Yee: Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc Natl Acad Sci U S A, 90(17), 8033-7 (1993)
doi:10.1073/pnas.90.17.8033
PMid:17636462
85. S. Shankar, I. Siddiqui and R. K. Srivastava: Molecular mechanisms of resveratrol (3,4,5-trihydroxy-trans-stilbene) and its interaction with TNF-related apoptosis inducing ligand (TRAIL) in androgen-insensitive prostate cancer cells. Mol Cell Biochem, 304(1-2), 273-85 (2007)
doi:10.1007/s11010-007-9510-x
PMid:20110806
86. G. Kallifatidis, V. Rausch, B. Baumann, A. Apel, B. M. Beckermann, A. Groth, J. Mattern, Z. Li, A. Kolb, G. Moldenhauer, P. Altevogt, T. Wirth, J. Werner, P. Schemmer, M. W. Buchler, A. V. Salnikov and I. Herr: Sulforaphane targets pancreatic tumor-initiating cells by NF-{kappa}B-induced anti-apoptotic signaling. Gut (2008)
doi:gut.2008.149039 (pii) 10.1136/gut.2008.149039
87. L. A. Boyer, T. I. Lee, M. F. Cole, S. E. Johnstone, S. S. Levine, J. P. Zucker, M. G. Guenther, R. M. Kumar, H. L. Murray, R. G. Jenner, D. K. Gifford, D. A. Melton, R. Jaenisch and R. A. Young: Core transcriptional regulatory circuitry in human embryonic stem cells. Cell, 122(6), 947-56 (2005)
doi:S0092-8674(05)00825-1 (pii) 10.1016/j.cell.2005.08.020
88. T. Kuroda, M. Tada, H. Kubota, H. Kimura, S. Y. Hatano, H. Suemori, N. Nakatsuji and T. Tada: Octamer and Sox elements are required for transcriptional cis regulation of Nanog gene expression. Mol Cell Biol, 25(6), 2475-85 (2005) doi:25/6/2475 (pii) 10.1128/MCB.25.6.2475-2485.2005
89. D. J. Rodda, J. L. Chew, L. H. Lim, Y. H. Loh, B. Wang, H. H. Ng and P. Robson: Transcriptional regulation of nanog by OCT4 and SOX2. J Biol Chem, 280(26), 24731-7 (2005)
doi:M502573200 (pii) 10.1074/jbc.M502573200
90. K. Mitsui, Y. Tokuzawa, H. Itoh, K. Segawa, M. Murakami, K. Takahashi, M. Maruyama, M. Maeda and S. Yamanaka: The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell, 113(5), 631-42 (2003)
doi:S0092867403003933 (pii)
91. I. Chambers, D. Colby, M. Robertson, J. Nichols, S. Lee, S. Tweedie and A. Smith: Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell, 113(5), 643-55 (2003) doi:S0092867403003921 (pii)
92. C. E. Hoei-Hansen, J. E. Nielsen, K. Almstrup, S. B. Sonne, N. Graem, N. E. Skakkebaek, H. Leffers and E. Rajpert-De Meyts: Transcription factor AP-2gamma is a developmentally regulated marker of testicular carcinoma in situ and germ cell tumors. Clin Cancer Res, 10(24), 8521-30 (2004) doi:10/24/8521 (pii) 10.1158/1078-0432.CCR-04-1285
93. M. Y. Wong and G. N. Chiu: Simultaneous liposomal delivery of quercetin and vincristine for enhanced estrogen-receptor-negative breast cancer treatment. Anticancer Drugs, 21(4), 401-10 (2010) doi:10.1097/CAD.0b013e328336e940
doi:10.1097/CAD.0b013e328336e940
PMid:11920648
94. U. Nothlings, S. P. Murphy, L. R. Wilkens, B. E. Henderson and L. N. Kolonel: Flavonols and pancreatic cancer risk: the multiethnic cohort study. Am J Epidemiol, 166(8), 924-31 (2007)
doi:kwm172 (pii) 10.1093/aje/kwm172
95. G. Bobe, S. J. Weinstein, D. Albanes, T. Hirvonen, J. Ashby, P. R. Taylor, J. Virtamo and R. Z. Stolzenberg-Solomon: Flavonoid intake and risk of pancreatic cancer in male smokers (Finland). Cancer Epidemiol Biomarkers Prev, 17(3), 553-62 (2008)
doi:17/3/553 (pii) 10.1158/1055-9965.EPI-07-2523
96. U. Nothlings, S. P. Murphy, L. R. Wilkens, H. Boeing, M. B. Schulze, H. B. Bueno-de-Mesquita, D. S. Michaud, A. Roddam, S. Rohrmann, A. Tjonneland, F. Clavel-Chapelon, A. Trichopoulou, S. Sieri, L. Rodriguez, W. Ye, M. Jenab and L. N. Kolonel: A food pattern that is predictive of flavonol intake and risk of pancreatic cancer. Am J Clin Nutr, 88(6), 1653-62 (2008)
doi:88/6/1653 (pii) 10.3945/ajcn.2008.26398
97. M. Mouria, A. S. Gukovskaya, Y. Jung, P. Buechler, O. J. Hines, H. A. Reber and S. J. Pandol: Food-derived polyphenols inhibit pancreatic cancer growth through mitochondrial cytochrome C release and apoptosis. Int J Cancer, 98(5), 761-9 (2002)
doi:10.1002/ijc.10202 (pii)
doi:10.1002/ijc.10202
PMid:12594539
98. C. Manach, G. Williamson, C. Morand, A. Scalbert and C. Remesy: Bioavailability and bioefficacy of polyphenols in humans. I. Review of 97 bioavailability studies. Am J Clin Nutr, 81(1 Suppl), 230S-242S (2005)
doi:81/1/230S (pii)
99. K. Nemeth, G. W. Plumb, J. G. Berrin, N. Juge, R. Jacob, H. Y. Naim, G. Williamson, D. M. Swallow and P. A. Kroon: Deglycosylation by small intestinal epithelial cell beta-glucosidases is a critical step in the absorption and metabolism of dietary flavonoid glycosides in humans. Eur J Nutr, 42(1), 29-42 (2003)
doi:10.1007/s00394-003-0397-3
PMid:3435494 PMCid:1148642
100. V. D. Bokkenheuser, C. H. Shackleton and J. Winter: Hydrolysis of dietary flavonoid glycosides by strains of intestinal Bacteroides from humans. Biochem J, 248(3), 953-6 (1987)
PMid:12649500 PMCid:1370415
101. K. Murota and J. Terao: Antioxidative flavonoid quercetin: implication of its intestinal absorption and metabolism. Arch Biochem Biophys, 417(1), 12-7 (2003)
doi:S0003986103002844 (pii)
102. A. J. Day, F. J. Canada, J. C. Diaz, P. A. Kroon, R. McLauchlan, C. B. Faulds, G. W. Plumb, M. R. Morgan and G. Williamson: Dietary flavonoid and isoflavone glycosides are hydrolysed by the lactase site of lactase phlorizin hydrolase. FEBS Lett, 468(2-3), 166-70 (2000)
doi:S0014-5793(00)01211-4 (pii)
103. G. Williamson, D. Barron, K. Shimoi and J. Terao: In vitro biological properties of flavonoid conjugates found in vivo. Free Radic Res, 39(5), 457-69 (2005)
doi:KCN6Q9QVPGK25999 (pii) 10.1080/10715760500053610
104. V. C. de Boer, A. A. Dihal, H. van der Woude, I. C. Arts, S. Wolffram, G. M. Alink, I. M. Rietjens, J. Keijer and P. C. Hollman: Tissue distribution of quercetin in rats and pigs. J Nutr, 135(7), 1718-25 (2005) doi:135/7/1718 (pii)
105. P. Ader, A. Wessmann and S. Wolffram: Bioavailability and metabolism of the flavonol quercetin in the pig. Free Radic Biol Med, 28(7), 1056-67 (2000)
doi:S0891-5849(00)00195-7 (pii)
106. E. J. Oliveira, D. G. Watson and M. H. Grant: Metabolism of quercetin and kaempferol by rat hepatocytes and the identification of flavonoid glycosides in human plasma. Xenobiotica, 32(4), 279-87 (2002) doi:10.1080/00498250110107886
doi:10.1080/00498250110107886
PMid:12028662
107. Y. Liu, Y. Dai, L. Xun and M. Hu: Enteric disposition and recycling of flavonoids and ginkgo flavonoids. J Altern Complement Med, 9(5), 631-40 (2003)
doi:10.1089/107555303322524481
doi:10.1089/107555303322524481
PMid:14629841
108. T. Walle, U. K. Walle and P. V. Halushka: Carbon dioxide is the major metabolite of quercetin in humans. J Nutr, 131(10), 2648-52 (2001)
PMid:11584085
109. P. C. Hollman and M. B. Katan: Absorption, metabolism and health effects of dietary flavonoids in man. Biomed Pharmacother, 51(8), 305-10 (1997)
doi:S0753332297880456 (pii)
110. T. Kitamura, J. Nakae, Y. Kitamura, Y. Kido, W. H. Biggs, 3rd, C. V. Wright, M. F. White, K. C. Arden and D. Accili: The forkhead transcription factor Foxo1 links insulin signaling to Pdx1 regulation of pancreatic beta cell growth. J Clin Invest, 110(12), 1839-47 (2002)
PMid:12488434 PMCid:151657
111. D. H. Castrillon, L. Miao, R. Kollipara, J. W. Horner and R. A. DePinho: Suppression of ovarian follicle activation in mice by the transcription factor Foxo3a. Science, 301(5630), 215-8 (2003)
doi:10.1126/science.1086336
PMid:12855809
112. J. Nakae, W. H. Biggs, 3rd, T. Kitamura, W. K. Cavenee, C. V. Wright, K. C. Arden and D. Accili: Regulation of insulin action and pancreatic beta-cell function by mutated alleles of the gene encoding forkhead transcription factor Foxo1. Nat Genet, 32(2), 245-53 (2002)
doi:10.1038/ng890
PMid:12219087
113. M. C. Hu, D. F. Lee, W. Xia, L. S. Golfman, F. Ou-Yang, J. Y. Yang, Y. Zou, S. Bao, N. Hanada, H. Saso, R. Kobayashi and M. C. Hung: IkappaB kinase promotes tumorigenesis through inhibition of forkhead FOXO3a. Cell, 117(2), 225-37 (2004)
PMid:15184386
114. T. Furuyama, K. Kitayama, Y. Shimoda, M. Ogawa, K. Sone, K. Yoshida-Araki, H. Hisatsune, S. Nishikawa, K. Nakayama, K. Ikeda, N. Motoyama and N. Mori: Abnormal angiogenesis in Foxo1 (Fkhr)-deficient mice. J Biol Chem, 279(33), 34741-9 (2004)
doi:10.1074/jbc.M314214200
PMid:17572301
M314214200 (pii)
115. E. Dejana, A. Taddei and A. M. Randi: Foxs and Ets in the transcriptional regulation of endothelial cell differentiation and angiogenesis. Biochim Biophys Acta, 1775(2), 298-312 (2007)
PMid:17258205
116. S. Chlench, N. Mecha Disassa, M. Hohberg, C. Hoffmann, T. Pohlkamp, G. Beyer, M. Bongrazio, L. Da Silva-Azevedo, O. Baum, A. R. Pries and A. Zakrzewicz: Regulation of Foxo-1 and the angiopoietin-2/Tie2 system by shear stress. FEBS Lett, 581(4), 673-80 (2007)
doi:10.1016/j.febslet.2007.01.028
PMid:16100571 PMCid:1184037
117. M. Potente, C. Urbich, K. Sasaki, W. K. Hofmann, C. Heeschen, A. Aicher, R. Kollipara, R. A. DePinho, A. M. Zeiher and S. Dimmeler: Involvement of Foxo transcription factors in angiogenesis and postnatal neovascularization. J Clin Invest, 115(9), 2382-92 (2005)
doi:10.1172/JCI23126
PMid:20012470
118. S. Shankar, Q. Chen and R. K. Srivastava: Inhibition of PI3K/AKT and MEK/ERK pathways act synergistically to enhance antiangiogenic effects of EGCG through activation of FOXO transcription factor. J Mol Signal, 3, 7 (2008)
doi:1750-2187-3-7 (pii) 10.1186/1750-2187-3-7
119. R. K. Srivastava, T. G. Unterman and S. Shankar: FOXO transcription factors and VEGF neutralizing antibody enhance antiangiogenic effects of resveratrol. Mol Cell Biochem, 337(1-2), 201-12 (2010)
doi:10.1007/s11010-009-0300-5
PMid:15084260
Key Words: Stem cells, pancreatic cancer, sulforaphane, quercetin, Nanog
Send correspondence to: Rakesh K. Srivastava, Department of Pharmacology, Toxicology and Therapeutics, and Medicine, The University of Kansas Cancer Center, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS, 66160, USA, Tel: 913-945-6686, Fax: 913-945-6058, E-mail:rsrivastava@kumc.edu