[Frontiers in Bioscience E4, 1049-1057, January 1, 2012]
LOH of PTCH1 region in BCC and ovarian carcinoma: microsatellite vs. HRM analysis
Vesna Musani1, Maja Sabol1, Diana Car1, Petar Ozretic1, Slavko Oreskovic2, Dinko Leovic3, Sonja Levanat1
1
TABLE OF CONTENTS
1. ABSTRACT
Loss of heterozygosity (LOH) of tumor suppressor genes is a frequent event in tumorigenesis. LOH is most often analyzed by microsatellite typing, but here we offer a fast and efficient method for simultaneous SNP genotyping and mutation scanning, which can also be used for LOH detection. High resolution melting (HRM) provides simple variant detection, and can be adopted for a wide range of applications. When a melting profile for a specific SNP is determined, the screening can be done without the need for sequencing, and only the melting profiles differing from the established melting profiles should be sequenced. LOH of PTCH1 gene is often found in a series of different tumors, for example basal cell carcinoma (BCC) and ovarian carcinoma (OC). In this study LOH was detected in 50% of BCC and 27.27% of OC, and the detection rates of microsatellite typing and HRM were comparable. Both methods depended only on the heterozygosity of the loci analyzed, but HRM offers an additional advantage of detection of all sequence variants in the gene of interest.
2. INTRODUCTION
Loss of heterozygosity (LOH) is a change from a state of heterozygosity in a normal genome to a homozygous state in a paired tumor genome. LOH is a sign of somatic deletion and is most often regarded as a mechanism for disabling tumor suppressor genes during the course of oncogenesis (1). Tumor suppressor genes are generally inactivated by an intragenic mutation within one allele and the subsequent loss of the corresponding (wild type) allele (2).
Identification of deleted regions usually relies on genotyping tumor and counterpart normal DNA with polymorphic DNA markers, such as microsatellites. Microsatellites are short, polymorphic, tandem repeat segments dispersed throughout the human genome. Most procedures to detect LOH are based on comparing alleles in tumor and normal tissue after PCR amplification with fluorescently labeled fragments, followed by capillary electrophoresis on an automated DNA sequencer (3).
High resolution melting (HRM) analysis is a simple, powerful and robust method for detecting DNA sequence variants. The method is based on differences in melting curves caused by variations in nucleotide sequence, detected as the change in fluorescence during the heating (melting) of the PCR product in the presence of the intercalating dye. The advantages of high resolution melting analysis for variant scanning include rapid turn-around times, a closed-system environment that greatly reduces contamination risk and, unlike other methods, no sample processing or separation after PCR. The method is an ideal choice for scanning of novel variants or genotyping known ones (4).
Patched (PTCH1) gene is a tumor suppressor gene associated with development of basocellular carcinomas (BCC) of the skin. It is a member of the Hedgehog-Gli (Hh-Gli) signaling pathway, a pathway that plays a major role in embryonic development and stem cell maintenance. The pathway is activated by binding of Hedgehog (Hh) protein to its transmembrane receptor Patched (Ptch). Ptch is then internalized, and releases its inhibition of Smoothened (Smo) protein, which is transported to the cell surface (reviewed in 5). A phosphorylation cascade is then triggered in the cytoplasm, leading to activation of transcription factor Gli, which translocates to the nucleus and triggers transcription of target genes: Cyclin D2, Cyclin E (6), members of the Wnt signaling pathway (7, 8), N-MYC (9), PTCH1 (10), Ceruloplasmin, ITIH3 (11), bcl-2 (12), FOXM1 (13).
PTCH1 gene is located on chromosome 9, in the chromosome region 9q22.32, with 24 exons stretching through 70 kb (14). PTCH1 gene has one polymorphic CGG repeat marker located directly upstream of the first ATG codon of exon 1b (rs71366293) (15), and at least 48 single nucleotide polymorphisms (SNP) throughout the gene (16), 7 of them common (17).
Germline mutations of the PTCH1 gene lead to Gorlin syndrome, a syndrome characterized with various developmental malformations and tumors (18, 19, 10). Tumor suppressor role of the gene causing the Gorlin syndrome was known even before it was cloned in 1996 (20). Even then LOH analysis was based on microsatellite markers throughout the whole 9q22.31-9q22.33 region. Sporadic mutations of the PTCH1 gene are involved in a series of sporadic tumors, including BCC (21, 22), medulloblastomas (23), skin trichoepitheliomas (24), esophageal squamous cell carcinomas (25), squamous cell carcinomas (26), breast cancer (23), as well as in odontogenic keratocysts (27).
According to the recent research, Hh-Gli signaling pathway is involved in one third of all malignant tumors, so it is becoming an interesting target for new cancer therapies (28). The role of Hh-Gli signaling pathway in ovarian carcinoma (OC) has been discovered only recently. Unlike healthy epithelial ovarian tissue, OC shows increased protein expression of the pathway members (29). Also, ovarian tumors often show LOH of the PTCH1 gene (30). Benign tumors of the ovary also show promoter hypermethylation (31), while OC do not (32).
We aim to provide evidence that the high resolution melting analysis is a simple, fast, accurate and inexpensive method to detect LOH, comparable to microsatellite analysis in both sensitivity and specificity.
3. MATERIALS AND METHODS
3.1. Patient samples and DNA extraction
Tumor tissue samples and blood samples from BCC patients were collected at Department of Maxillofacial Surgery, Clinical Hospital Osijek, in Osijek, Croatia. Tumor tissue samples and blood samples from OC patients were collected at Department of Obstetrics and Gynecology, Zagreb University School of Medicine, in Zagreb, Croatia. All samples were collected with patients' consent according to Declaration of Helsinki, and ethical committees of both institutions approved the study. In total 25 BCC samples from 19 patients (13 patients with one BCC each and six patients with two BCCs each: samples BCC3 and BCC4; BCC6 and BCC7; BCC10 and BCC11; BCC13 and BCC14; BCC16 and BCC17; and BCC24 and BCC25 were collected from patients with two BCCs) and 12 OC samples from 12 patients were collected. DNA was extracted from tissues using the standard phenol-chloroform method, and from blood using the desalting method (33).
3.2. Microsatellite analysis of LOH
LOH analysis was done using fluorescent labeled forward primers, followed by fragmental analysis detection on ABI PRISM 310 Genetic Analyzer (Applied Biosystems, USA), using the GeneMapper v.3.0 (Applied Biosystems, USA) and Microsoft Excel 2002 (Microsoft, USA). DNA of 25 BCC and 12 OC samples together with their matching DNA from blood were typed for CGG repeat in 5'UTR of PTCH1 gene (rs71366293) using following primers: F: 5' CCCCCGCGCAATGTGGCAATGGAA '3 and R: 5' CGTTACCAGCCGAGGCCATGTT '3. Samples that were uninformative were further typed for three additional STR markers (D9S196, D9S287 and D9S180) (17). The sample was considered LOH positive when at least one locus showed LOH. PCR conditions for CGG repeat were: initial denaturation at 95�C for 10 min, followed by 30 cycles of 95�C 30 s, 61�C 2 min, 72�C 1 min, and final extension at 72�C 30 min using AmpliTaq Gold polymerase (Applied Biosystems, USA). PCR conditions for the multiplex PCR with other STR markers: initial denaturation at 95�C for 15 min, followed by 19 cycles of 95�C 30 s, 55�C 90 s, 72�C 1 min, and final extension at 72�C 30 min using QIAGEN Multiplex PCR kit (QIAGEN, Germany).
3.3. High resolution melting analysis of SNPs
PCR reactions were performed in a 10 �l reaction mixture in Roche LightCycler capillaries using the following components: 50 ng template DNA, 0.2 mM dNTPs (Roche, Germany), 0.4 U FastStart Taq DNA Polymerase (Roche, Germany), 1x fluorescent dye LCGreen Plus (Idaho Technology, USA), 2 mM MgCl2 (Idaho Technology, USA) and forward and reverse primers (0.5 mM each) for each gene segment. PCR reaction was performed in an adapted RapidCycler2 instrument (Idaho Technology, USA). Coding region of the PTCH1 gene was split into 24 PCR products, sized between 168 and 428 bp. PCR conditions were optimized to temperatures between 52�C and 64�C for each segment. After 40 cycles of amplification, PCR products underwent an additional 1 min at 98�C and then 5 min at 40�C to promote heteroduplex formation. Each capillary was then transferred to the HR-1 High Resolution Melter instrument (Idaho Technology, USA) for high resolution melting and curve analysis. Samples were melted at 0.2�C/s ramp rate (34). Melting profiles were analyzed with HR-1 software v.1.511 using fluorescence normalization, temperature shift and conversion to difference and derivative plots. Paired blood and tissue samples were compared, and samples showing a difference in melting profiles were sequenced.
3.4. DNA sequencing
Before sequencing, the chosen PCR products were purified with ExoSAP-IT (USB, USA) and then sequenced in both directions using the Big Dye Terminator 1.1 Cycle Sequencing kit (Applied Biosystems, USA). Sequencing reaction was performed on an automatic sequencer ABI PRISM 310 Genetic Analyzer (Applied Biosystems, USA), and sequences were analyzed using BioEdit program v.7.0.5.3.
3.5. Statistical analysis
Kappa statistics (35) were used for evaluating inter-rater agreement between two LOH analysis methods and kappa values were interpreted according to Landis and Koch (36). Fisher's exact test was used for assessing difference in LOH distribution between BCC and OC samples (two-tailed P value < 0.05 was considered statistically significant). Statistical analyses were performed with MedCalc for Windows, version 11.4.2.0 (MedCalc Software, Belgium).
4. RESULTS
4.1. Microsatellite analysis
LOH of the PTCH1 region was determined in 10 of 25 BCC from 9 patients (40%) (Figure 1, Table 1-left pane). Twelve BCC samples from 11 patients had no LOH, while 3 samples from 2 patients were uninformative for all 4 markers used (D9S196, rs71366293, D9S287 and D9S180). So the prevalence of LOH in BCC was 45.45% (10/22). Six patients had two BCCs analyzed. Of those, three had LOH in one tumor but not in the other, one had LOH in both tumors, one had no LOH, and one was uninformative for all markers. In OC samples, LOH of the PTCH1 region was determined in 3 of 12 cases (25%) (Table 1-left pane). Seven OC samples had no LOH, and 2 samples were uninformative for all markers analyzed. The prevalence of LOH in OC was 30% (3/10).
4.2. HRM analysis
Using the HRM analysis and sequencing, LOH was detected in BCC samples with SNPs located in exons 5 (c.735A>G), 12 (c.1665T>C, c.1686C>T), 14 (c.2199A>G) and 23 (c.3944C>T), and introns 1 (c.202-539delC), 5 (c.747-55T>C), 10 (c.1504-51C>G) and 15 (c.2560+9G>C) (Figure 2, Figure 3, Table 1-right pane). We considered 1 informative SNP enough evidence for confirmation of LOH, and in all samples analyzed all SNPs corresponded together, that is, when more than one SNP was informative they all either showed LOH or did not. LOH was detected in 10 BCC samples, with 1 up to 4 SNPs being informative. Eleven samples showed no LOH, with 1 to 4 SNPs being informative. Four samples were homozygous for all PTCH1 exons analyzed, so no information about LOH could be gathered. The prevalence of LOH in BCCs detected by HRM was 47.6% (10/21). In ovarian carcinoma samples LOH was found in exons 12 (c.1686CT) and 23 (c.3944C>T), and introns 1 (c.202-539delC), 5 (c.747-55T>C) and 15 (c.2560+9G>C). LOH was found in 3 samples, with 4 or 5 SNPs being informative (Table 1-right pane). LOH was not found in 7 samples, with 2 up to 6 SNPs being informative. Two samples were homozygous for all PTCH1 exons analyzed, so no information about LOH could be gathered. In ovarian carcinomas, the prevalence of LOH detected by HRM was 30% (3/10)
4.3. Comparison of two methods
The inter-rater agreement between microsatellite and HRM LOH analyses obtained a kappa value of 0.821, what can be interpreted as very good agreement (Table 2-upper half). When we excluded samples that were uninformative by either method, the kappa value was even higher: 0.932 (Table 2-lower half). For BCC samples, data from microsatellite and HRM analyses corresponded in nine samples that showed LOH, 11 samples that did not show LOH and three samples that were uninformative. The results did not match in two cases: in one case (BCC18) microsatellite analysis showed LOH, while the HRM analysis was uninformative. In this case the microsatellite analysis showed itself to be more accurate. In the second case (BCC21), the microsatellite analysis showed no LOH, while the HRM analysis showed LOH in 4 SNPs. Here the HRM analysis was more accurate. For OC samples, data from two analyses corresponded in three samples that showed LOH, 6 samples that showed no LOH, and one uninformative sample. The data did not match in two cases. In one case (OC5) the microsatellite analysis showed no LOH, while the SNPs were uninformative, and in the second (OC10), the microsatellites were uninformative; while the SNPs showed that there was no LOH. Combining the results from both methods, the prevalence of LOH in BCCs was 50.0% (11/22) while in OC samples was 27.27% (3/11). There was no statistically significant difference between the prevalence in BCCs and OC (P=0.278, Figure 4).
5. DISCUSSION
High resolution melting analysis has mostly been used for mutation scanning or genotyping (detection of SNPs) in a variety of different systems (reviewed in 37). So far only one paper mentions the possibility of LOH detection using melting curve analysis (38), although a similar concept was established previously using denaturing high-performance liquid chromatography (dHPLC) (39). LOH has previously mostly been detected by microsatellite typing (3). More recently, oligonucleotide SNP arrays have become another tool for LOH detection although it is limited by availability (1). HRM has become widely available in a variety of applications, which has been demonstrated by the number of publications in the recent years (reviewed in 4).
In our research we compared the HRM approach with the classic microsatellite analysis. We determined that LOH can be easily detected using HRM when comparing melting curves from blood and tissue samples, on SNP locations. In these cases there is a visible difference in melting curve profiles between tumor and blood sample from the same patient. Usually the difference is a clear shift of the melting profile from a heterozygous towards wild type or homozygous form, indicating complete or partial loss of one of the alleles. When a melting profile for a specific SNP is determined, the screening can be done without the need for sequencing, and only the melting profiles differing from the established melting profiles should be sequenced or analyzed by other methods.
The detection rate between HRM and microsatellite analysis was comparable, and both were dependent on the heterozygosity of the used loci. The prevalence of LOH was 50% for BCC, and 27.27% for OC. In literature the prevalence of LOH in BCCs is between 35 and 75% (40, 22, 41, 42, 26) and 70% for ovarian tumors, both benign and malignant (30). Our data is comparable with published data for BCC, but is significantly lower for OC. That is probably because of the small number of our OC samples, but we are confident in our results, because of high agreement of both methods used.
When we compared the HRM and microsatellite analyses, our data corresponded in most samples. The data differed in four samples, two BCCs and two OC. In one sample (BCC18), microsatellite analysis showed LOH, while it was uninformative for the SNPs. While we can predict that this means the sample has the LOH in the PTCH1 gene, since the microsatellite marker (D9S180) is almost 2 Mb away, we cannot say anything for certain. In the second BCC case (BCC21), where the microsatellite analysis showed no LOH, while the HRM analysis showed LOH, we can be 100% confident that there is a LOH in the PTCH1 gene. In one OC case (OC5), where the microsatellite analysis showed no LOH and the SNPs were uninformative, we cannot say for sure if there really was no LOH (again because of the 2 Mb distance of D9S180). For the second OC case (OC10), the microsatellites were uninformative, while the SNPs confirmed that there was no LOH. So, while in two cases the microsatellites were more informative, due to the distance of markers used, it cannot be certain that the PTCH1 gene itself was lost. In the second two cases, where the SNPs were more informative, the data is more certain, because the SNPs are located in the gene itself.
The only limitation of the HRM method (as well as the microsatellite, or SNP microarray) is the need for SNPs. There are some methods for LOH detection that do not need SNPs, such as Multiplex ligation-dependent probe amplification (MLPA) (43), comparative genomic hybridization (CGH) (44), or whole genome sequencing but they are still not widely used.
For researchers interested in complete genetic analysis of a gene, we recommend HRM as the method of choice, due to its ability to perform scanning for point mutations and LOH analysis in the same reaction. Here we show it with the PTCH1 gene, but the method could be equally applied to any gene containing common SNPs.
6. ACKNOWLEDGEMENTS
This work was supported by The Croatian Ministry of Science, Education and Sports, Republic of Croatia, grant number: 098-0982464-2461. The authors wish to thank the patients who agreed to participate in this study, and Mirela Levacic Cvok, for the assistance in the experimental work.
7. REFERENCES
1. R. Beroukhim, M. Lin, Y. Park, K. Hao, X. Zhao, L. A. Garraway, E. A. Fox, E. P. Hochberg, I. K. Mellinghoff, M. D. Hofer, A. Descazeaud, M. A. Rubin, M. Meyerson, W. H. Wong, W. R. Sellers and C. Li: Inferring loss-of-heterozygosity from unpaired tumors using high-density oligonucleotide SNP arrays. PLoS Comput Biol 2:e41, 323-332 (2006)
10.1371/journal.pcbi.0020041
2. A. G. Knudson: Antioncogenes and human cancer. Proc Natl Acad Sci U S A 90, 10914-10921 (1993)
doi:10.1073/pnas.90.23.10914
3. F. Canzian, R. Salovaara, A. Hemminki, P. Kristo, R. B. Chadwick, L. A. Aaltonen and A. de la Chapelle: Semiautomated assessment of loss of heterozygosity and replication error in tumors. Cancer Res 56, 3331-3337 (1996)
4. J. L. Montgomery, L. N. Sanford and C. T. Wittwer: High-resolution DNA melting analysis in clinical research and diagnostics. Expert Rev Mol Diagn 10, 219-240 (2010)
doi:10.1586/erm.09.84
5. Y. Wang, A. P. McMahon and B. L. Allen: Shifting paradigms in Hedgehog signaling. Curr Opin Cell Biol 19, 159-165 (2007)
doi:10.1016/j.ceb.2007.02.005
6. M. Duman-Scheel, L. Weng, S. Xin and W. Du: Hedgehog regulates cell growth and proliferation by inducing Cyclin D and Cyclin E. Nature 417, 299-304 (2002)
doi:10.1038/417299a
7. J. L. Mullor, N. Dahmane, T. Sun and A. Ruiz i Altaba: Wnt signals are targets and mediators of Gli function. Curr Biol 11, 769-773 (2001)
doi:10.1016/S0960-9822(01)00229-9
8. X. Li, W. Deng, S. M. Lobo-Ruppert and J. M. Ruppert: Gli1 acts through Snail and E-Cadherin to promote nuclear signaling by β-catenin. Oncogene 26, 4489-4498 (2007)
doi:10.1038/sj.onc.1210241
9. T. G. Oliver, L. L. Grasfeder, A. L. Carroll, C. Kaiser, C. L. Gillingham, S. M. Lin, R. Wickramasinghe, M. P. Scott and R. J. Weschler-Reya: Transcriptional profiling of the Sonic hedgehog response: a critical role for N-myc in proliferation of neuronal precursors. PNAS 100, 7331-7336 (2003)
doi:10.1073/pnas.0832317100
10. S. S. Cross and J. P. Bury: The hedgehog signaling pathways in human pathology. Curr Diag Pathol 10, 157-168 (2003)
doi:10.1016/j.cdip.2003.11.005
11. M. Kato, N. Seki, S. Sugano, K. Hashimoto, Y. Masuho, M. Muramatsu, K. Kaibuchi and M. Nakafuku: Identification of Sonic Hedgehog-responsive genes using cDNA microarray. Biochem Biophys Res Comm 289, 472-478 (2001)
doi:10.1006/bbrc.2001.5976
12. R. L. Bigelow, N. S. Chari, A. B. Undén, K. B. Spurgers, S. Lee, D. R. Roop, R. Toftgård and T. J. McDonnell: Transcriptional regulation of bcl-2 mediated by the Sonic Hedgehog signaling pathway through gli-1. J Biol Chem 279, 1197-1205 (2004)
doi:10.1074/jbc.M310589200
13. M.-T. Teh, S.-T. Wong, G. W. Neill, L. R. Ghali, M. P. Phillpot and A. G. Quinn: FOXM1 is a downstream target of Gli1 in basal cell carcinomas. Cancer Res 62, 4773-4780 (2002)
14. R. D. Klein, D. J. Dykas and A. E. Bale: Clinical testing for the nevoid basal cell carcinoma syndrome in a DNA diagnostic laboratory. Genet Med 7, 611-619 (2005)
doi:10.1097/01.gim.0000182879.57182.b4
15. K. Nagao, K. Fujii, M. Yamada and T. Miyashita: Identification of a novel polymorphism involving a CGG repeat in the PTCH gene and a genome-wide screening of CGG-containing genes. J Hum Genet 49, 97-101 (2004)
doi:10.1007/s10038-003-0117-0
16. E. Lindström, T. Shimokawa, R. Toftgård and P. G. Zaphiropoulos: PTCH mutations: distribution and analyses. Hum Mutat 27, 215-219 (2006)
doi:10.1002/humu.20296
17. S. Levanat, V. Musani, A. Komar and S. Oreskovic: Role of the hedgehog/patched signaling pathway in oncogenesis: a new polymorphism in the PTCH gene in ovarian fibroma. Ann N Y Acad Sci 1030, 134-143 (2004)
doi:10.1196/annals.1329.017
18. H. Hahn, C. Wicking, P. G. Zaphiropoulous, M. R. Gailani, S. Shanley, A. Chidambaram, I. Vorechovsky, E. Holmberg, A. B. Unden, S. Gillies, K. Negus, I. Smyth, C. Pressman, D. J. Leffell, B. Gerrard, A. M. Goldstein, M. Dean, R. Toftgard, G. Chenevix-Trench, B. Wainwright and A. E. Bale: Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 85, 841-851 (1996)
doi:10.1016/S0092-8674(00)81268-4
19. R. L. Johnson, A. L. Rothman, J. Xie, L. V. Goodrich, J. W. Bare, J. M. Bonifas, A. G. Quinn, R. M. Myers, D. R. Cox, E. H. Epstein Jr and M. P. Scott: Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 272, 1668-1671 (1996)
doi:10.1126/science.272.5268.1668
20. S. Levanat, R. J. Gorlin, S. Fallet, D. R. Johnson, J. E. Fantasia and A. E. Bale: A two-hit model for developmental defects in Gorlin syndrome. Nat Genet 12, 85-87 (1996)
doi:10.1038/ng0196-85
21. M. Wolter, J. Reifenberger, C. Sommer, T. Ruzicka and G. Reifenberger: Mutations in the human homologue of the Drosophila segment polarity gene patched (PTCH) in sporadic basal cell carcinomas of the skin and primitive neuroectodermal tumors of the central nervous system. Cancer Res 57, 2581-2585 (1997)
22. E. Heitzer, A. Lassacher, F. Quehenberger, H. Kerl and P. Wolf: UV fingerprints predominate in the PTCH mutation spectra of basal cell carcinomas independent of clinical phenotype. J Invest Dermatol 127, 2872-2881 (2007)
http://dx.doi.org/10.1038/sj.jid.5700923
23. J. Xie, R. L. Johnson, X. Zhang, J. W. Bare, F. M. Waldman, P. H. Cogen, A. G. Menon, R. S. Warren, L. C. Chen, M. P. Scott and E. H. Epstein Jr: Mutations of the PATCHED gene in several types of sporadic extracutaneous tumors. Cancer Res 57, 2369-2372 (1997)
24. I. Vorechovský, A. B. Undén, B. Sandstedt, R. Toftgård and M. Ståhle-Bäckdahl: Trichoepitheliomas contain somatic mutations in the overexpressed PTCH gene: support for a gatekeeper mechanism in skin tumorigenesis. Cancer Res 57, 4677-4681 (1997)
25. C. Maesawa, G. Tamura, T. Iwaya, S. Ogasawara, K. Ishida, N. Sato, S. Nishizuka, Y. Suzuki, K. Ikeda, K. Aoki, K. Saito and R. Satodate: Mutations in the human homologue of the Drosophila patched gene in esophageal squamous cell carcinoma. Genes Chromosomes Cancer 21, 276-279 (1998)
doi:10.1002/(SICI)1098-2264(199803)21:3<276::AID-GCC15>3.0.CO;2-N
26. H. Danaee, M. R. Karagas, K. T. Kelsey, A. E. Perry and H. H. Nelson: Allelic loss at Drosophila patched gene is highly prevalent in Basal and Squamous Cell Carcinomas of the skin. J Invest Dermatol 126, 1152-1158 (2006)
doi:10.1038/sj.jid.5700209
27. S. Pan, L. L. Xu, L. S. Sun and T. J. Li: Identification of known and novel PTCH mutations in both syndromic and non-syndromic keratocystic odontogenic tumors. Int J Oral Sci 1, 34-38 (2009)
doi:10.4248/IJOS.08013
28. S. J. Scales and F. J. de Sauvage: Mechanisms of Hedgehog pathway activation in cancer and implications for therapy. Trends Pharmacol Sci 30, 303-312 (2009)
doi:10.1016/j.tips.2009.03.007
29. X. Chen, A. Horiuchi, N. Kikuchi, R. Osada, J. Yoshida, T. Shiozawa and I. Konishi: Hedgehog signal pathway is activated in ovarian carcinomas, correlating with cell proliferation: it's inhibition leads to growth suppression and apoptosis. Cancer Sci 98, 68-76 (2007)
doi:10.1111/j.1349-7006.2006.00353.x
30. J. Byrom, V. Mudaliar, C. W. Redman, P. Jones, R. C. Strange and P. R. Hoban: Loss of heterozygosity at chromosome 9q22-31 is a frequent and early event in ovarian tumors. Int J Oncol 24, 1271-1277 (2004)
31. M. Cretnik, V. Musani, S. Oreskovic, D. Leovic and S. Levanat: The Patched gene is epigenetically regulated in ovarian dermoids and fibromas, but not in basocellular carcinomas. Int J Mol Med 19, 875-883 (2007)
32. Z. M. Löf-Öhlin, S. Levanat, M. Sabol, B. Sorbe and T. K. Nilsson: Promoter methylation in the PTCH gene in cervical epithelial cancer and ovarian cancer tissue as studied by eight novel Pyrosequencing® assays. Int J Oncol 38, 685-692 (2011)
doi:10.3892/ijo.2011.895
33. S. A. Miller, D. D. Dykes and H. F. Polesky: A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16, 1215 (1988)
doi:10.1093/nar/16.3.1215
34. M. L. Cvok, M. Cretnik, V. Musani, P. Ozretic and S. Levanat: New sequence variants in BRCA1 and BRCA2 genes detected by high-resolution melting analysis in an elderly healthy female population in Croatia. Clin Chem Lab Med 46, 1376-1383 (2008)
doi:10.1515/CCLM.2008.307
35. J. Cohen: A coefficient of agreement for nominal scales. Educ Psychol Meas, 20, 37-46 (1960)
doi:10.1177/001316446002000104
36. J. R. Landis and G. G. Koch: The measurement of observer agreement for categorical data. Biometrics, 33, 159-174 (1977)
doi:10.2307/2529310
37. M. G. Herrmann, J. D. Durtschi, C. T. Wittwer and K. V. Voelkerding: Expanded instrument comparison of amplicon DNA melting analysis for mutation scanning and genotyping. Clin Chem 53, 1544-1548 (2007)
doi:10.1373/clinchem.2007.088120
38. D. Vageli, Z. Daniil, J. Dahabreh, E. Karagianni, T. Liloglou, G. Koukoulis and K. Gourgoulianis: Microsatellite instability and loss of heterozygosity at the MEN1 locus in lung carcinoid tumors: A novel approach using real-time PCR with melting curve analysis in histopathologic material. Oncol Rep 15, 557-564 (2006)
39. E. Kleymenova and C. L. Walker: Determination of loss of heterozygosity in frozen and paraffin embedded tumors by denaturing high-performance liquid chromatography (DHPLC). J Biochem Biophys Methods 47, 83-90 (2001)
doi:10.1016/S0165-022X(00)00154-8
40. K. Iwata, N. Takamura, M. Nakashima, G. Alipov, M. Mine, N. Matsumoto, K. Yoshiura, Y. Prouglo, I. Sekine, I. Katayama and S. Yamashita: Loss of heterozygosity on chromosome 9q22.3 in microdissected basal cell carcinomas around the Semipalatinsk Nuclear Testing Site, Kazakhstan. Hum Pathol 35, 460-464 (2004)
doi:10.1016/j.humpath.2003.09.021
41. J. Reifenberger, M. Wolter, C. B. Knobbe, B. Köhler, A. Schönicke, C. Scharwächter, K. Kumar, B. Blaschke, T. Ruzicka and G. Reifenberger: Somatic mutations in the PTCH, SMOH, SUFUH and TP53 genes in sporadic basal cell carcinomas. Br J Dermatol 152, 43-51 (2005)
doi:10.1111/j.1365-2133.2005.06353.x
42. M. Y. Kim, H. J. Park, S. C. Baek, D. G. Byun and D. Houh: Mutations of the p53 and PTCH gene in basal cell carcinomas: UV mutation signature and strand bias. J Dermatol Sci 29, 1-9 (2002)
doi:10.1016/S0923-1811(01)00170-0
43. C. Franco-Hernández, V. Martínez-Glez, J. M. de Campos, A. Isla, J. Vaquero, M. Gutiérrez, C. Casartelli and J. A. Rey: Allelic status of 1p and 19q in oligodendrogliomas and glioblastomas: multiplex ligation-dependent probe amplification versus loss of heterozygosity. Cancer Genet Cytogenet 190, 93-96 (2009)
doi:10.1016/j.cancergencyto.2008.09.017
44. K. Agelopoulos, N. Tidow, E. Korsching, R. Voss, B. Hinrichs, B. Brandt, W. Boecker and H. Buerger: Molecular cytogenetic investigations of synchronous bilateral breast cancer. J Clin Pathol 56, 660-665 (2003)
doi:10.1136/jcp.56.9.660
Abbreviations: LOH: loss of heterozygosity, HRM: high resolution melting, PTCH1: Patched1 gene, BCC: basal cell carcinoma, Hh: Hedgehog protein, Ptch: Patched protein, Smo: Smoothened protein, OC: ovarian carcinoma, UTR: untranslated region, STR: short tandem repeat, SNP: single nucleotide polymorphism, PCR: polymerase chain reaction, dNTP: deoxyribonucleotide triphosphate, dHPLC: denaturating high performance liquid chromatography, Mb: megabase, MLPA: multiplex ligation-dependent probe amplification, CGH: comparative genomic hybridization, HET: heterozygous, HO: homozygous, N: normal, UI: uninformative, ND: not done
Key words: loss of heterozygosity, high resolution melting, PTCH1, basal cell carcinoma, ovarian carcinoma
Send correspondence to: Sonja Levanat, Division of Molecular Medicine, Rudjer Boskovic Institute, Bijenicka 54, 10002 Zagreb, Croatia, Tel: 385-1-4561110, Fax: 385-1-4561010, E-mail:levanat@irb.hr