[Frontiers in Bioscience E3, 125-136, January 1, 2011]

BRCA1-related gene signature in breast cancer: the role of ER status and molecular type

Katarzyna Marta Lisowska1, Volha Dudaladava1,2, Michal Jarzab1, Tomasz Huzarski3, Ewa Chmielik4, Ewa Stobiecka4, Jan Lubinski3, Barbara Jarzab5

1Department of Tumor Biology, Maria Sklodowska-Curie Memorial Cancer Center and Institute of Oncology, Gliwice Branch, Gliwice, Poland, 2currently: Department of Medical Biology and Genetics, Grodno State Medical University, Grodno, Belarus, 3International Hereditary Cancer Center, Pomeranian Medical University, Szczecin, Poland, 4Department of Pathology Maria Sklodowska-Curie Memorial Cancer Center and Institute of Oncology, Gliwice Branch, Gliwice, Poland, 5Department of Nuclear Medicine and Endocrine Oncology, Maria Sklodowska-Curie Memorial Cancer Center and Institute of Oncology, Gliwice Branch, Gliwice, Poland

TABLES

Table 1. Characteristics of tumor samples used in microarray experiment

No

Sample name

Germ-line BRCA1/2 mutation

Group

ER status, est. by IHC1

Molecular subtype, acc. to (7)

Histology

BRCA1 promoter methylation

1

t01

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Medullary

-

2

t02

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Ductal

-

3

t09A

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Ductal

-

4

t09B

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Ductal

-

5

t11

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Medullary

-

6

t12

BRCA1 4153delA Ex11

BRCA1

Negative

Basal

Ductal

-

7

t14

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Medullary

-

8

t17

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Ductal

-

9

t21

BRCA1 C61G Ex5

BRCA1

Negative

Basal

Ductal

-

10

t26

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Ductal

-

11

t28

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Ductal

-

12

t33

BRCA1 5382insC Ex20

BRCA1

Negative

Basal

Ductal

-

13

t10

BRCA2 9631delC Ex25

BRCA2

Positive

Luminal

Ductal

-

14

t04

No mutation

BRCAx

Negative

Basal

Ductal

-

15

t19

No mutation

BRCAx

Negative

Basal

Ductal

Methylated

16

t24

No mutation

BRCAx

Negative

Basal

Ductal

-

17

t32

No mutation

BRCAx

Negative

Luminal

Ductal

-

18

t35

No mutation

BRCAx

Negative

Luminal

Ductal

-

19

t08

No mutation

BRCAx

Positive

Luminal

Ductal

-

20

t36

No mutation

BRCAx

Positive

Luminal

Ductal

-

21

t37

No mutation

BRCAx

Positive

Luminal

Ductal

-

22

t06

No mutation

Sporadic

Negative

Basal

Medullary

Methylated

23

t07

No mutation

Sporadic

Negative

Basal

Ductal

Methylated

24

t13

No mutation

Sporadic

Negative

Basal

Medullary

-

25

t20

No mutation

Sporadic

Negative

Luminal

Ductal

-

26

t22

No mutation

Sporadic

Negative

Luminal

Ductal

-

27

t27

No mutation

Sporadic

Negative

Luminal

Ductal

-

28

t29

No mutation

Sporadic

Negative

Luminal

Ductal

-

29

t31

No mutation

Sporadic

Negative

Basal

Ductal

Methylated

30

t34

No mutation

Sporadic

Negative

Basal

Ductal

-

31

t05

No mutation

Sporadic

Positive

Luminal

Ductal

-

32

t15

No mutation

Sporadic/FCA

Negative

Luminal

Ductal

-

33

t18

No mutation

Sporadic/FCA

Positive

Luminal

Ductal

-

34

t25

No mutation

Sporadic/FCA

Negative

Basal

Ductal

Methylated

35

t30

No mutation

Sporadic/FCA

Negative

Basal

Ductal

Methylated

1 - ER status estimated by immunohistochemistry

Table 2. Oligonucleotide primers used in real-time RT-PCR

Gene

Sequence

Product size (bp)

EIF4G2

F 5`- GCAAGGCTTTGTTCCAGGTGA -3`

R 5`- AGGCTTTGGCTGGTTCTTTAGTCA -3`

100

FANCA

F 5`- TCCCCACCTGATTCTCTGTCATGT -3`

R 5`- GAGGCTCCGTCAACTAAGTGAGA -3`

218

HIP2

F 5`- GCAATGACTCTCCGCACGGTA -3`

R 5`- GCCCAAAGTCGAGCTGTCTG -3`

140

TOB1

F 5`- ATTGTTTCTACGACATGGTATTGCATTTA -3`

R 5`- CAAGTATTCGTACATTTTAATTCCACCACT -3`

182

Table 3. Summary of the microarray data analyses

No

Subject of analysis

Samples compared

No of genes

See results

 

A. Summary of the univariate comparisons

1.

BRCA1

mutation status

BRCA1-mutated versus

all other breast ca.

234 (p less than 0.001)

GT: p=0.001

Supplementary Tab. 1

 

2.

BRCA1

mutation status

BRCA1-mutated versus

all sporadic breast ca.

41 (p less than 0.001)

GT: p=0.065

-

 

3.

BRCA1

mutation status

BRCA1-mutated versus

ER (-), sporadic breast ca.

27 (p less than 0.001)

GT: p=0.16

-

 

4.

Comparison of BRCA1 inactivation pathways

BRCA1-mutated versus

BRCA1-methylated

43 (p less than 0.001)

GT: p=0.24

-

 

5.

BRCA1 inactivation status

BRCA1-mutated or BRCA1-methylated versus all other breast ca.

609 (p less than 0.001)

GT: p=0.001

Supplementary Tab. 3

 

B. Summary of the results of two-way ANOVA comparisons

No

First variable

Second variable

No of genes

No of genes

See results

1.

BRCA1 mutation

ER status

BRCA1 mutation:

0 (FDR less than 20%)

101 (p-value less than 0.001)

ER status:

1380 (FDR less than 20%)

Supplementary Tab. 2

2.

BRCA1 mutation

molecular subtype

BRCA1 mutation:

0 (FDR 20%)

37 (p-value less than 0.001)

Molecular subtype:

5705 (FDR less than 20%)

1222 (p-value less than 0.001)

Supplementary Tab. 5

3.

BRCA1 inactivation

ER status

BRCA1 inactive:

259 (FDR less than 10%)

250 (p-value less than 0.001)

ER status:

101 (FDR less than 10%)

185 (p-value less than 0.001)

Supplementary Tab. 4

4.

BRCA1 inactivation

molecular subtype

BRCA1 inactive:

0 (FDR less than 20%)

57 ( p-value less than 0.001)

Molecular subtype:

2441 (FDR less than 20%)

526 (p-value less than 0.001)

Supplementary Tab. 6

Table 4. Selected genes used in class prediction procedure

Gene symbol

Probe set

Gene description

Rank

Parametric p-value

BRCA1-mutated tumors1

Non-mutated tumors2

Ratio3

TOB1

202704_at

transducer of ERBB2, 1

7

0,0003488

1583,9

4277,1

0,37

DAPK1

203139_at

death-associated protein kinase 1

9

0,0003939

419

148,1

2,829

SMAD1

227798_at

SMAD, mothers against DPP homolog 1 (Drosophila)

18

0,0005539

740,1

1541

0,48

RASEF

1553986_at

RAS and EF-hand domain containing

22

0,0006355

19,9

158

0,126

EML1

204797_s_at

echinoderm microtubule associated protein like 1

36

0,0008215

21

60,2

0,349

GSTP1

200824_at

glutathione S-transferase pi

42

0,0010103

2294,4

847,6

2,707

MTA3

223311_s_at

metastasis associated 1 family, member 3

46

0,0010825

246,5

477,2

0,517

FLRT3

222853_at

fibronectin leucine rich transmembrane protein 3

53

0,0011724

3,8

25

0,152

RHOB

212099_at

ras homolog gene family, member B

57

0,0012658

1558,3

5337,6

0,292

RAB15

59697_at

RAB15, member RAS onocogene family

60

0,0013082

23,6

59,4

0,397

DNAJC1

242216_at

DnaJ (Hsp40) homolog, subfamily C, member 1

65

0,0013974

16,1

51,3

0,314

PIK3R3

202743_at

phosphoinositide-3-kinase, regulatory subunit 3 (p55, gamma)

69

0,0015051

1270,9

3043,1

0,418

HIST3H2A

221582_at

histone 3, H2a

73

0,0015822

1181

396,8

2,976

IL10RB

227125_at

Interleukin 10 receptor, beta

74

0,001599

367,4

177,4

2,071

S100A11

208540_x_at

S100 calcium binding protein A11 (calgizzarin)

88

0,001887

8431,2

6111,5

1,38

SEMA3C

203788_s_at

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C

94

0,0020362

8,1

16,7

0,485

CASP9

203984_s_at

caspase 9, apoptosis-related cysteine peptidase

96

0,002097

163,9

245,3

0,668

LOC643998

227663_at

Similar to cadherin 12, type 2 preproprotein

99

0,0021606

140,5

575,2

0,244

PDPK1

224986_s_at

3-phosphoinositide dependent protein kinase-1

109

0,0022685

389,7

658,9

0,591

COL4A3BP

223465_at

collagen, type IV, alpha 3 (Goodpasture antigen) binding protein

114

0,002372

41,3

92

0,449

RAPGEF2

238176_at

Rap guanine nucleotide exchange factor (GEF) 2

115

0,0023811

71,6

210,3

0,34

ARHGEF1

203055_s_at

Rho guanine nucleotide exchange factor (GEF) 1

116

0,0024038

48,7

33,7

1,445

IL20RA

219115_s_at

interleukin 20 receptor, alpha

120

0,0024981

5,8

21

0,276

AMACR

209426_s_at

alpha-methylacyl-CoA racemase

133

0,0027655

21,9

54,7

0,4

GRLF1

229394_s_at

glucocorticoid receptor DNA binding factor 1

137

0,002844

1078,5

2014,7

0,535

H2AFV

212205_at

H2A histone family, member V

140

0,0029347

1101,5

1710,8

0,644

MTA1

211783_s_at

metastasis associated 1

142

0,0029635

818,7

1368,4

0,598

SEPHS2

200961_at

selenophosphate synthetase 2

146

0,0030547

1454

2507,6

0,58

CA12

203963_at

carbonic anhydrase XII

148

0,0031106

49,3

562

0,088

RASGEF1A

242917_at

RasGEF domain family, member 1A

152

0,0032499

7,6

5,8

1,31

RAB15

221810_at

RAB15, member RAS onocogene family

159

0,0034652

29,4

77,5

0,379

RAB33B

221014_s_at

RAB33B, member RAS oncogene family

160

0,0034734

150,2

264,6

0,568

MARK3

202569_s_at

MAP/microtubule affinity-regulating kinase 3

161

0,0034856

338,9

507,7

0,668

MAP1S

218522_s_at

microtubule-associated protein 1S

164

0,0035946

312,9

196,4

1,593

TNFRSF19L

227060_at

tumor necrosis factor receptor superfamily, member 19-like

169

0,0036711

64,3

35,4

1,816

DIDO1

227335_at

death inducer-obliterator 1

182

0,0038991

199,4

387,2

0,515

TPD52L1

210372_s_at

tumor protein D52-like 1

195

0,0041787

44,8

163,5

0,274

RASSF4

221578_at

Ras association (RalGDS/AF-6) domain family 4

202

0,0043726

7,6

4,8

1,583

ALCAM

201951_at

activated leukocyte cell adhesion molecule

215

0,0045987

143,2

508,7

0,282

HIP2

202347_s_at

huntingtin interacting protein 2

221

0,004798

498,5

844,9

0,59

USP33

214843_s_at

ubiquitin specific peptidase 33

238

0,0051181

224,2

357,9

0,626

REEP6

226597_at

receptor accessory protein 6

259

0,0057829

3,7

27,2

0,136

BAG5

202984_s_at

BCL2-associated athanogene 5

288

0,0063224

34,9

103,6

0,337

STAT3

208992_s_at

signal transducer and activator of transcription 3 (acute-phase response factor)

291

0,0063687

1258,1

606,8

2,073

RASSF4

226436_at

Ras association (RalGDS/AF-6) domain family 4

294

0,0064893

1444,1

505,9

2,855

PAPPA

224940_s_at

pregnancy-associated plasma protein A, pappalysin 1

300

0,0066921

37,7

10

3,77

GATA3

209602_s_at

GATA binding protein 3

311

0,0070165

98,1

750,3

0,131

MAP4K3

218311_at

mitogen-activated protein kinase kinase kinase kinase 3

314

0,0071634

328,4

598,7

0,549

AKT1

207163_s_at

v-akt murine thymoma viral oncogene homolog 1

317

0,0073108

454,3

820,3

0,554

MRAS

206538_at

muscle RAS oncogene homolog

326

0,0075287

51,5

25,2

2,044

FANCA

236976_at

Fanconi anemia, complementation group A

330

0,0075988

93,5

31,4

2,978

LTB

207339_s_at

lymphotoxin beta (TNF superfamily, member 3)

334

0,0076744

193

55,1

3,503

MKNK2

218205_s_at

MAP kinase interacting serine/threonine kinase 2

335

0,0076756

1974

3836,5

0,515

SPOCK2

202524_s_at

sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2

342

0,0077511

146,3

52,7

2,776

IKBKB

209341_s_at

inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta

348

0,0078492

368,4

836,8

0,44

ICAM1

202637_s_at

intercellular adhesion molecule 1 (CD54), human rhinovirus receptor

354

0,0080214

716,1

232,7

3,077

PSMB9

204279_at

proteasome (prosome, macropain) subunit, beta type, 9

359

0,0081462

1940,7

737,3

2,632

MKI67

212020_s_at

antigen identified by monoclonal antibody Ki-67

368

0,0085212

146,1

47,2

3,095

USP53

231817_at

ubiquitin specific peptidase 53

372

0,0086144

97,9

252,8

0,387

STAT1

200887_s_at

signal transducer and activator of transcription 1, 91kDa

380

0,0087024

5674,1

3224,6

1,76

GPR176

227846_at

G protein-coupled receptor 176

389

0,0089517

268,5

110,5

2,43

ERBB2IP

217941_s_at

erbb2 interacting protein

391

0,0089844

1153,5

1731,7

0,666

SELENBP1

214433_s_at

selenium binding protein 1

410

0,0095837

136,6

566,8

0,241

Full list contains 423 genes (see Supplementary Table 8). Only characterized genes with potential or proven association with cancer are shown. 1Geometrical mean of signal intensities observed in tumor samples from woman with BRCA1 mutation; 2Geometrical mean of signal intensities observed in samples from woman without BRCA1 mutation; 3Ratio of geometrical means of signals: "BRCA1-mutated" to "non-mutated".

Table 5. Results of real-time RT-PCR validation

Gene

BRCA1-mutated, ER-negative:

n=10

median (IQR)

non-mutated,
ER-negative:

n=12

median (IQR)

non-mutated,
ER-positive:

n=5

median (IQR)

p-value

ER-negative only:

BRCA1-mutated
vs. non-mutated

p-value

all tumors:

BRCA1-mutated
vs. non-mutated

p-value

all tumors:

ER-positive vs.

ER-negative

TOB1

1.01 (0.71)

1.65 (0.92)

2.61 (3.12)

0.04

0.004

0.001

HIP2

0.30 (0.19)

0.47 (0.27)

0.41 (0.44)

0.04

0.07

n.s.

FANCA

0.69 (2.24)

4.49 (5.51)

0.38 (2.32)

n.s.

n.s.

n.s.

Data are presented as median values, with interquartile range (IQR) given in parentheses. Kolmogorov-Smirnov non-parametric test with exact two-sided p-values was used to estimate significance of the differences; n.s. - non significant